Incidental Mutation 'R5261:Olfr995'
ID401418
Institutional Source Beutler Lab
Gene Symbol Olfr995
Ensembl Gene ENSMUSG00000075218
Gene Nameolfactory receptor 995
SynonymsGA_x6K02T2Q125-46915844-46914897, MOR203-3
MMRRC Submission 042830-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.133) question?
Stock #R5261 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location85437528-85443639 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 85438897 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 87 (V87A)
Ref Sequence ENSEMBL: ENSMUSP00000149952 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099924] [ENSMUST00000214679] [ENSMUST00000216933] [ENSMUST00000217218]
Predicted Effect probably benign
Transcript: ENSMUST00000099924
AA Change: V87A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000097508
Gene: ENSMUSG00000075218
AA Change: V87A

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 4.1e-50 PFAM
Pfam:7tm_1 41 290 2.3e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000214679
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215758
Predicted Effect probably benign
Transcript: ENSMUST00000216933
AA Change: V87A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000217218
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.5%
  • 20x: 93.1%
Validation Efficiency 96% (64/67)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6430573F11Rik T C 8: 36,511,924 I227T probably benign Het
6820408C15Rik C G 2: 152,440,857 P211A probably damaging Het
Ambra1 G A 2: 91,885,606 V761M probably damaging Het
Amfr T A 8: 93,976,170 probably null Het
Asphd1 C A 7: 126,946,115 A357S probably benign Het
Brd3 C A 2: 27,463,919 Q60H probably damaging Het
Cd96 T A 16: 46,069,653 M336L probably benign Het
Cep152 T A 2: 125,564,205 H1469L probably benign Het
Coro1a G T 7: 126,700,644 probably null Het
D630045J12Rik A T 6: 38,194,620 L871Q probably benign Het
Depdc5 C T 5: 32,938,291 P824L probably damaging Het
Enpep T G 3: 129,305,426 D467A probably damaging Het
Extl2 G A 3: 116,027,364 A273T probably benign Het
Foxi3 T A 6: 70,960,516 F218Y probably damaging Het
Golga2 A G 2: 32,304,154 M521V probably benign Het
Gpr142 T A 11: 114,804,342 N44K probably damaging Het
Gtf2ird2 A G 5: 134,216,219 I440V probably benign Het
Gucy1b2 T A 14: 62,404,579 K698I probably damaging Het
Hspa1b T C 17: 34,959,007 M1V probably null Het
Ints9 T A 14: 65,008,072 Y260N probably benign Het
Khdc3 T G 9: 73,103,486 V182G possibly damaging Het
Ky A G 9: 102,537,599 probably null Het
Map2k1 T A 9: 64,191,561 I263F probably damaging Het
Olfr328 T C 11: 58,552,051 S63G probably benign Het
Olfr46 A C 7: 140,610,663 I166L probably benign Het
Otogl T A 10: 107,777,592 H2004L probably benign Het
Palmd T C 3: 116,923,360 H496R probably benign Het
Papolb C G 5: 142,529,654 R78P possibly damaging Het
Pcdh10 G A 3: 45,381,812 G854R probably damaging Het
Pdcd11 A G 19: 47,113,537 I1054V probably benign Het
Pik3ap1 A T 19: 41,376,106 L58Q probably damaging Het
Ppp2ca A G 11: 52,099,110 K21R probably benign Het
Prmt5 A C 14: 54,507,916 I598S probably damaging Het
Pycr1 T A 11: 120,641,224 I239F probably damaging Het
R3hdm2 C T 10: 127,498,416 R896C probably damaging Het
Rev3l C T 10: 39,846,729 P699S probably damaging Het
Samd1 CGAGGAGGAGGAGGAGGAGGA CGAGGAGGAGGAGGAGGA 8: 83,998,996 probably benign Het
Sel1l A T 12: 91,824,884 M351K possibly damaging Het
Sesn2 A G 4: 132,499,306 L159P probably damaging Het
Slc35f4 T A 14: 49,303,489 probably benign Het
Slc3a1 C A 17: 85,051,975 N409K probably damaging Het
Slc45a2 C T 15: 11,027,785 T480I probably damaging Het
Slco1c1 T C 6: 141,546,776 F246S probably damaging Het
Socs2 T G 10: 95,392,819 I190L unknown Het
Srsf1 T A 11: 88,047,858 I7N possibly damaging Het
Stox1 T A 10: 62,667,841 H145L probably damaging Het
Trap1 A T 16: 4,056,422 I243N probably damaging Het
Trav7-3 T C 14: 53,443,750 I83T probably benign Het
Tuft1 A T 3: 94,639,405 I42K possibly damaging Het
Umps A G 16: 33,966,974 V3A probably benign Het
Vim A C 2: 13,574,832 E134A probably null Het
Vmn1r28 C A 6: 58,265,539 H122Q probably benign Het
Vps51 T G 19: 6,071,033 E283D probably benign Het
Vsig10l T A 7: 43,470,850 V760D probably damaging Het
Xrn1 A G 9: 96,045,543 D1460G probably benign Het
Zfp282 A G 6: 47,897,890 D343G probably damaging Het
Zfp35 A G 18: 24,003,721 H374R probably damaging Het
Other mutations in Olfr995
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02102:Olfr995 APN 2 85438267 missense probably damaging 1.00
IGL02540:Olfr995 APN 2 85438915 missense probably benign 0.05
IGL02687:Olfr995 APN 2 85438586 missense possibly damaging 0.93
IGL02713:Olfr995 APN 2 85438637 missense probably damaging 0.99
R0318:Olfr995 UTSW 2 85438237 missense possibly damaging 0.91
R0463:Olfr995 UTSW 2 85438286 missense probably damaging 1.00
R0638:Olfr995 UTSW 2 85438501 missense probably benign 0.03
R1668:Olfr995 UTSW 2 85438876 missense probably benign 0.00
R1718:Olfr995 UTSW 2 85438805 missense probably benign 0.39
R4981:Olfr995 UTSW 2 85438469 missense probably damaging 1.00
R7036:Olfr995 UTSW 2 85438430 missense probably damaging 1.00
R7899:Olfr995 UTSW 2 85438397 missense probably benign 0.39
R7982:Olfr995 UTSW 2 85438397 missense probably benign 0.39
Predicted Primers PCR Primer
(F):5'- CTGAACACAAACTTGTCGAGAC -3'
(R):5'- ACTGACTTCTATCTTCTGGGATTTG -3'

Sequencing Primer
(F):5'- CAAACTTGTCGAGACATGATTATGGG -3'
(R):5'- AATACTCAGAGTATCCTCTTCGTTG -3'
Posted On2016-07-06