Incidental Mutation 'R5261:Pcdh10'
ID401422
Institutional Source Beutler Lab
Gene Symbol Pcdh10
Ensembl Gene ENSMUSG00000049100
Gene Nameprotocadherin 10
Synonyms6430521D13Rik, OL-pc, 6430703F07Rik
MMRRC Submission 042830-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.261) question?
Stock #R5261 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location45378398-45435623 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 45381812 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Arginine at position 854 (G854R)
Ref Sequence ENSEMBL: ENSMUSP00000141529 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000166126] [ENSMUST00000170695] [ENSMUST00000171554] [ENSMUST00000193252]
Predicted Effect probably damaging
Transcript: ENSMUST00000166126
AA Change: G854R

PolyPhen 2 Score 0.959 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000131073
Gene: ENSMUSG00000049100
AA Change: G854R

DomainStartEndE-ValueType
CA 34 120 1.64e-2 SMART
CA 144 248 1.46e-12 SMART
CA 272 356 2.88e-25 SMART
CA 380 461 1.9e-25 SMART
CA 485 572 1.8e-26 SMART
CA 603 686 8.29e-17 SMART
low complexity region 687 697 N/A INTRINSIC
Pfam:Cadherin_C_2 713 838 5e-23 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000170695
AA Change: G854R

PolyPhen 2 Score 0.959 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000132769
Gene: ENSMUSG00000049100
AA Change: G854R

DomainStartEndE-ValueType
CA 34 120 1.64e-2 SMART
CA 144 248 1.46e-12 SMART
CA 272 356 2.88e-25 SMART
CA 380 461 1.9e-25 SMART
CA 485 572 1.8e-26 SMART
CA 603 686 8.29e-17 SMART
low complexity region 687 697 N/A INTRINSIC
transmembrane domain 716 738 N/A INTRINSIC
low complexity region 751 772 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000171554
AA Change: G854R

PolyPhen 2 Score 0.917 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000131600
Gene: ENSMUSG00000049100
AA Change: G854R

DomainStartEndE-ValueType
CA 34 120 1.64e-2 SMART
CA 144 248 1.46e-12 SMART
CA 272 356 2.88e-25 SMART
CA 380 461 1.9e-25 SMART
CA 485 572 1.8e-26 SMART
CA 603 686 8.29e-17 SMART
low complexity region 687 697 N/A INTRINSIC
transmembrane domain 716 738 N/A INTRINSIC
low complexity region 751 772 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181047
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191843
Predicted Effect probably damaging
Transcript: ENSMUST00000193252
AA Change: G854R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000141529
Gene: ENSMUSG00000049100
AA Change: G854R

DomainStartEndE-ValueType
CA 34 120 1.64e-2 SMART
CA 144 248 1.46e-12 SMART
CA 272 356 2.88e-25 SMART
CA 380 461 1.9e-25 SMART
CA 485 572 1.8e-26 SMART
CA 603 686 8.29e-17 SMART
low complexity region 687 697 N/A INTRINSIC
transmembrane domain 716 738 N/A INTRINSIC
low complexity region 751 772 N/A INTRINSIC
low complexity region 887 896 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195655
Meta Mutation Damage Score 0.2838 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.5%
  • 20x: 93.1%
Validation Efficiency 96% (64/67)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the protocadherin gene family, a subfamily of the cadherin superfamily. This family member contains 6 extracellular cadherin domains, a transmembrane domain and a cytoplasmic tail differing from those of the classical cadherins. The encoded protein is a cadherin-related neuronal receptor thought to function in the establishment of specific cell-cell connections in the brain. This gene plays a role in inhibiting cancer cell motility and cell migration. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jan 2015]
PHENOTYPE: Mice homozygous for a reporter allele die within several weeks of birth and exhibit decreased body size and defective striatal axon growth and thalamocortical projections in the ventral telencephalon. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6430573F11Rik T C 8: 36,511,924 I227T probably benign Het
6820408C15Rik C G 2: 152,440,857 P211A probably damaging Het
Ambra1 G A 2: 91,885,606 V761M probably damaging Het
Amfr T A 8: 93,976,170 probably null Het
Asphd1 C A 7: 126,946,115 A357S probably benign Het
Brd3 C A 2: 27,463,919 Q60H probably damaging Het
Cd96 T A 16: 46,069,653 M336L probably benign Het
Cep152 T A 2: 125,564,205 H1469L probably benign Het
Coro1a G T 7: 126,700,644 probably null Het
D630045J12Rik A T 6: 38,194,620 L871Q probably benign Het
Depdc5 C T 5: 32,938,291 P824L probably damaging Het
Enpep T G 3: 129,305,426 D467A probably damaging Het
Extl2 G A 3: 116,027,364 A273T probably benign Het
Foxi3 T A 6: 70,960,516 F218Y probably damaging Het
Golga2 A G 2: 32,304,154 M521V probably benign Het
Gpr142 T A 11: 114,804,342 N44K probably damaging Het
Gtf2ird2 A G 5: 134,216,219 I440V probably benign Het
Gucy1b2 T A 14: 62,404,579 K698I probably damaging Het
Hspa1b T C 17: 34,959,007 M1V probably null Het
Ints9 T A 14: 65,008,072 Y260N probably benign Het
Khdc3 T G 9: 73,103,486 V182G possibly damaging Het
Ky A G 9: 102,537,599 probably null Het
Map2k1 T A 9: 64,191,561 I263F probably damaging Het
Olfr328 T C 11: 58,552,051 S63G probably benign Het
Olfr46 A C 7: 140,610,663 I166L probably benign Het
Olfr995 A G 2: 85,438,897 V87A probably benign Het
Otogl T A 10: 107,777,592 H2004L probably benign Het
Palmd T C 3: 116,923,360 H496R probably benign Het
Papolb C G 5: 142,529,654 R78P possibly damaging Het
Pdcd11 A G 19: 47,113,537 I1054V probably benign Het
Pik3ap1 A T 19: 41,376,106 L58Q probably damaging Het
Ppp2ca A G 11: 52,099,110 K21R probably benign Het
Prmt5 A C 14: 54,507,916 I598S probably damaging Het
Pycr1 T A 11: 120,641,224 I239F probably damaging Het
R3hdm2 C T 10: 127,498,416 R896C probably damaging Het
Rev3l C T 10: 39,846,729 P699S probably damaging Het
Samd1 CGAGGAGGAGGAGGAGGAGGA CGAGGAGGAGGAGGAGGA 8: 83,998,996 probably benign Het
Sel1l A T 12: 91,824,884 M351K possibly damaging Het
Sesn2 A G 4: 132,499,306 L159P probably damaging Het
Slc35f4 T A 14: 49,303,489 probably benign Het
Slc3a1 C A 17: 85,051,975 N409K probably damaging Het
Slc45a2 C T 15: 11,027,785 T480I probably damaging Het
Slco1c1 T C 6: 141,546,776 F246S probably damaging Het
Socs2 T G 10: 95,392,819 I190L unknown Het
Srsf1 T A 11: 88,047,858 I7N possibly damaging Het
Stox1 T A 10: 62,667,841 H145L probably damaging Het
Trap1 A T 16: 4,056,422 I243N probably damaging Het
Trav7-3 T C 14: 53,443,750 I83T probably benign Het
Tuft1 A T 3: 94,639,405 I42K possibly damaging Het
Umps A G 16: 33,966,974 V3A probably benign Het
Vim A C 2: 13,574,832 E134A probably null Het
Vmn1r28 C A 6: 58,265,539 H122Q probably benign Het
Vps51 T G 19: 6,071,033 E283D probably benign Het
Vsig10l T A 7: 43,470,850 V760D probably damaging Het
Xrn1 A G 9: 96,045,543 D1460G probably benign Het
Zfp282 A G 6: 47,897,890 D343G probably damaging Het
Zfp35 A G 18: 24,003,721 H374R probably damaging Het
Other mutations in Pcdh10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00863:Pcdh10 APN 3 45380302 missense probably damaging 1.00
IGL01115:Pcdh10 APN 3 45392775 missense probably damaging 1.00
IGL01535:Pcdh10 APN 3 45379643 missense probably damaging 1.00
IGL01600:Pcdh10 APN 3 45379487 missense probably damaging 0.98
IGL01625:Pcdh10 APN 3 45379397 missense probably damaging 0.99
IGL01966:Pcdh10 APN 3 45380298 missense probably benign 0.05
IGL02232:Pcdh10 APN 3 45380942 missense probably benign 0.00
IGL02490:Pcdh10 APN 3 45380487 missense probably damaging 1.00
IGL02890:Pcdh10 APN 3 45392617 missense probably damaging 1.00
IGL02976:Pcdh10 APN 3 45380013 missense possibly damaging 0.92
IGL02997:Pcdh10 APN 3 45379362 missense probably damaging 1.00
IGL03006:Pcdh10 APN 3 45379502 missense probably damaging 0.99
IGL03385:Pcdh10 APN 3 45381512 missense possibly damaging 0.77
R0025:Pcdh10 UTSW 3 45380499 missense possibly damaging 0.93
R0157:Pcdh10 UTSW 3 45379701 missense probably damaging 1.00
R0372:Pcdh10 UTSW 3 45379497 missense probably damaging 1.00
R0652:Pcdh10 UTSW 3 45379764 missense probably damaging 1.00
R0760:Pcdh10 UTSW 3 45380570 missense probably benign 0.19
R0976:Pcdh10 UTSW 3 45380801 missense probably damaging 1.00
R1307:Pcdh10 UTSW 3 45381879 missense probably benign 0.00
R1466:Pcdh10 UTSW 3 45379974 missense probably damaging 1.00
R1466:Pcdh10 UTSW 3 45379974 missense probably damaging 1.00
R1510:Pcdh10 UTSW 3 45379403 missense probably damaging 1.00
R1619:Pcdh10 UTSW 3 45380312 missense possibly damaging 0.94
R1678:Pcdh10 UTSW 3 45381881 nonsense probably null
R1687:Pcdh10 UTSW 3 45380015 missense probably damaging 1.00
R1750:Pcdh10 UTSW 3 45381881 nonsense probably null
R1751:Pcdh10 UTSW 3 45384177 missense probably damaging 1.00
R1767:Pcdh10 UTSW 3 45384177 missense probably damaging 1.00
R1857:Pcdh10 UTSW 3 45379937 missense possibly damaging 0.86
R2086:Pcdh10 UTSW 3 45380471 missense probably damaging 0.98
R3960:Pcdh10 UTSW 3 45379314 missense probably benign
R4083:Pcdh10 UTSW 3 45392707 missense probably damaging 1.00
R4084:Pcdh10 UTSW 3 45392707 missense probably damaging 1.00
R4112:Pcdh10 UTSW 3 45381620 missense probably damaging 1.00
R4754:Pcdh10 UTSW 3 45380637 missense probably damaging 0.99
R4946:Pcdh10 UTSW 3 45379482 missense probably damaging 1.00
R5039:Pcdh10 UTSW 3 45381861 missense probably damaging 1.00
R5224:Pcdh10 UTSW 3 45392814 missense probably damaging 0.99
R5233:Pcdh10 UTSW 3 45384191 missense probably damaging 1.00
R5429:Pcdh10 UTSW 3 45384200 missense probably benign 0.00
R5488:Pcdh10 UTSW 3 45381368 missense probably damaging 1.00
R5558:Pcdh10 UTSW 3 45384168 missense probably damaging 1.00
R5784:Pcdh10 UTSW 3 45380640 missense probably damaging 1.00
R5815:Pcdh10 UTSW 3 45392721 missense probably benign 0.04
R6283:Pcdh10 UTSW 3 45381554 missense possibly damaging 0.46
R6396:Pcdh10 UTSW 3 45380060 missense possibly damaging 0.46
R6703:Pcdh10 UTSW 3 45381299 missense possibly damaging 0.87
R6756:Pcdh10 UTSW 3 45380106 missense possibly damaging 0.80
R6968:Pcdh10 UTSW 3 45379542 missense probably damaging 1.00
R7463:Pcdh10 UTSW 3 45383572 missense possibly damaging 0.59
R7574:Pcdh10 UTSW 3 45381375 missense possibly damaging 0.92
R7691:Pcdh10 UTSW 3 45381197 missense probably damaging 1.00
R7795:Pcdh10 UTSW 3 45380222 missense probably benign 0.09
R8057:Pcdh10 UTSW 3 45379259 missense probably benign 0.00
X0013:Pcdh10 UTSW 3 45379566 missense probably damaging 1.00
Z1177:Pcdh10 UTSW 3 45381729 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- ATCATGTTGGTGCAGAGCGC -3'
(R):5'- GTGGAGTGCAGTCAGAACAC -3'

Sequencing Primer
(F):5'- AGAGCGCCAACGTCCCTAG -3'
(R):5'- GGTGATAAAAGGTGACCCCCAATC -3'
Posted On2016-07-06