Mutagenetix > Incidental Mutations

Incidental Mutation 'R5261:Olfr46'

401439

Institutional Source

Beutler Lab

Gene Symbol

Olfr46

Ensembl Gene

ENSMUSG00000093942

Gene Name

olfactory receptor 46

Synonyms

ID12, IF5, MOR253-8, GA_x6K02T2PBJ9-42759973-42760905, IB7

MMRRC Submission

042830-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.105) question?

Stock #

R5261 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

140601269-140617678 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to C at 140610663 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Leucine at position 166 (I166L)

Ref Sequence

ENSEMBL: ENSMUSP00000072445 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000072655] [ENSMUST00000211771] [ENSMUST00000214180]

AlphaFold

Q8VGJ4

Predicted Effect

probably benign
Transcript: ENSMUST00000072655
AA Change: I166L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000072445
Gene: ENSMUSG00000093942
AA Change: I166L

Domain	Start	End	E-Value	Type
Pfam:7tm_4	39	315	1.1e-50	PFAM
Pfam:7TM_GPCR_Srsx	43	209	5.9e-8	PFAM
Pfam:7tm_1	49	298	3.4e-21	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000211771
AA Change: I158L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

Predicted Effect

probably benign
Transcript: ENSMUST00000214180
AA Change: I158L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.1%
3x: 98.3%
10x: 96.5%
20x: 93.1%

Validation Efficiency

96% (64/67)

MGI Phenotype

FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 57 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
6430573F11Rik	T	C	8: 36,511,924	I227T	probably benign	Het
6820408C15Rik	C	G	2: 152,440,857	P211A	probably damaging	Het
Ambra1	G	A	2: 91,885,606	V761M	probably damaging	Het
Amfr	T	A	8: 93,976,170		probably null	Het
Asphd1	C	A	7: 126,946,115	A357S	probably benign	Het
Brd3	C	A	2: 27,463,919	Q60H	probably damaging	Het
Cd96	T	A	16: 46,069,653	M336L	probably benign	Het
Cep152	T	A	2: 125,564,205	H1469L	probably benign	Het
Coro1a	G	T	7: 126,700,644		probably null	Het
D630045J12Rik	A	T	6: 38,194,620	L871Q	probably benign	Het
Depdc5	C	T	5: 32,938,291	P824L	probably damaging	Het
Enpep	T	G	3: 129,305,426	D467A	probably damaging	Het
Extl2	G	A	3: 116,027,364	A273T	probably benign	Het
Foxi3	T	A	6: 70,960,516	F218Y	probably damaging	Het
Golga2	A	G	2: 32,304,154	M521V	probably benign	Het
Gpr142	T	A	11: 114,804,342	N44K	probably damaging	Het
Gtf2ird2	A	G	5: 134,216,219	I440V	probably benign	Het
Gucy1b2	T	A	14: 62,404,579	K698I	probably damaging	Het
Hspa1b	T	C	17: 34,959,007	M1V	probably null	Het
Ints9	T	A	14: 65,008,072	Y260N	probably benign	Het
Khdc3	T	G	9: 73,103,486	V182G	possibly damaging	Het
Ky	A	G	9: 102,537,599		probably null	Het
Map2k1	T	A	9: 64,191,561	I263F	probably damaging	Het
Olfr328	T	C	11: 58,552,051	S63G	probably benign	Het
Olfr995	A	G	2: 85,438,897	V87A	probably benign	Het
Otogl	T	A	10: 107,777,592	H2004L	probably benign	Het
Palmd	T	C	3: 116,923,360	H496R	probably benign	Het
Papolb	C	G	5: 142,529,654	R78P	possibly damaging	Het
Pcdh10	G	A	3: 45,381,812	G854R	probably damaging	Het
Pdcd11	A	G	19: 47,113,537	I1054V	probably benign	Het
Pik3ap1	A	T	19: 41,376,106	L58Q	probably damaging	Het
Ppp2ca	A	G	11: 52,099,110	K21R	probably benign	Het
Prmt5	A	C	14: 54,507,916	I598S	probably damaging	Het
Pycr1	T	A	11: 120,641,224	I239F	probably damaging	Het
R3hdm2	C	T	10: 127,498,416	R896C	probably damaging	Het
Rev3l	C	T	10: 39,846,729	P699S	probably damaging	Het
Samd1	CGAGGAGGAGGAGGAGGAGGA	CGAGGAGGAGGAGGAGGA	8: 83,998,996		probably benign	Het
Sel1l	A	T	12: 91,824,884	M351K	possibly damaging	Het
Sesn2	A	G	4: 132,499,306	L159P	probably damaging	Het
Slc35f4	T	A	14: 49,303,489		probably benign	Het
Slc3a1	C	A	17: 85,051,975	N409K	probably damaging	Het
Slc45a2	C	T	15: 11,027,785	T480I	probably damaging	Het
Slco1c1	T	C	6: 141,546,776	F246S	probably damaging	Het
Socs2	T	G	10: 95,392,819	I190L	unknown	Het
Srsf1	T	A	11: 88,047,858	I7N	possibly damaging	Het
Stox1	T	A	10: 62,667,841	H145L	probably damaging	Het
Trap1	A	T	16: 4,056,422	I243N	probably damaging	Het
Trav7-3	T	C	14: 53,443,750	I83T	probably benign	Het
Tuft1	A	T	3: 94,639,405	I42K	possibly damaging	Het
Umps	A	G	16: 33,966,974	V3A	probably benign	Het
Vim	A	C	2: 13,574,832	E134A	probably null	Het
Vmn1r28	C	A	6: 58,265,539	H122Q	probably benign	Het
Vps51	T	G	19: 6,071,033	E283D	probably benign	Het
Vsig10l	T	A	7: 43,470,850	V760D	probably damaging	Het
Xrn1	A	G	9: 96,045,543	D1460G	probably benign	Het
Zfp282	A	G	6: 47,897,890	D343G	probably damaging	Het
Zfp35	A	G	18: 24,003,721	H374R	probably damaging	Het

Other mutations in Olfr46

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00340:Olfr46	APN	7	140610753	missense	probably damaging	1.00
IGL02408:Olfr46	APN	7	140610931	missense	probably damaging	1.00
IGL02496:Olfr46	APN	7	140610168	start codon destroyed	probably benign
IGL03003:Olfr46	APN	7	140610370	missense	probably damaging	1.00
R0538:Olfr46	UTSW	7	140610384	missense	probably damaging	1.00
R1350:Olfr46	UTSW	7	140610709	missense	probably damaging	0.96
R1466:Olfr46	UTSW	7	140610969	missense	probably benign	0.01
R1466:Olfr46	UTSW	7	140610969	missense	probably benign	0.01
R2008:Olfr46	UTSW	7	140610585	missense	probably damaging	1.00
R4110:Olfr46	UTSW	7	140610264	missense	probably benign	0.20
R4110:Olfr46	UTSW	7	140610265	missense	possibly damaging	0.89
R4255:Olfr46	UTSW	7	140610587	nonsense	probably null
R4622:Olfr46	UTSW	7	140610698	nonsense	probably null
R4809:Olfr46	UTSW	7	140611074	missense	probably damaging	0.98
R4826:Olfr46	UTSW	7	140610319	missense	probably benign	0.02
R4989:Olfr46	UTSW	7	140610391	missense	possibly damaging	0.95
R5177:Olfr46	UTSW	7	140610189	missense	probably benign	0.00
R5770:Olfr46	UTSW	7	140610943	missense	probably damaging	1.00
R5863:Olfr46	UTSW	7	140610631	missense	probably damaging	0.97
R6082:Olfr46	UTSW	7	140610681	missense	probably benign	0.00
R6705:Olfr46	UTSW	7	140610784	missense	probably damaging	0.99
R7216:Olfr46	UTSW	7	140610460	missense	possibly damaging	0.87
R7443:Olfr46	UTSW	7	140611048	missense	probably damaging	1.00
R7485:Olfr46	UTSW	7	140610178	missense	probably benign	0.02
R7806:Olfr46	UTSW	7	140610772	missense	probably benign	0.00
R8373:Olfr46	UTSW	7	140610295	missense	possibly damaging	0.88
R8884:Olfr46	UTSW	7	140610703	missense	probably damaging	1.00
R9278:Olfr46	UTSW	7	140611023	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GTCTGAGGAAAACACCATCTCC -3'
(R):5'- TGATGCAGCCATAGGATAGC -3'

Sequencing Primer
(F):5'- TCCTTCAAAGGGTGCATGAC -3'
(R):5'- TGCAGCCATAGGATAGCAAGGTAAG -3'

Posted On

2016-07-06