Mutagenetix > Incidental Mutation

Incidental Mutation 'R5261:Ints9'

401463

Institutional Source

Beutler Lab

Gene Symbol

Ints9

Ensembl Gene

ENSMUSG00000021975

Gene Name

integrator complex subunit 9

Synonyms

D14Ertd231e

MMRRC Submission

042830-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R5261 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

64950045-65039832 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 65008072 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Asparagine at position 260 (Y260N)

Ref Sequence

ENSEMBL: ENSMUSP00000045552 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000043914]

AlphaFold

Q8K114

Predicted Effect

probably benign
Transcript: ENSMUST00000043914
AA Change: Y260N

PolyPhen 2 Score 0.250 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000045552
Gene: ENSMUSG00000021975
AA Change: Y260N

Domain	Start	End	E-Value	Type
Pfam:Lactamase_B_6	91	289	1.2e-17	PFAM
Beta-Casp	334	462	7.65e-16	SMART
low complexity region	583	596	N/A	INTRINSIC
low complexity region	672	682	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000224593

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000225790

Meta Mutation Damage Score

0.1138

Coding Region Coverage

1x: 99.1%
3x: 98.3%
10x: 96.5%
20x: 93.1%

Validation Efficiency

96% (64/67)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of the Integrator complex. This protein complex binds the C-terminal domain of RNA polymerase II and likely plays a role in small nuclear RNA processing. The encoded protein has similarities to the subunits of the cleavage and polyadenylation specificity factor complex. Alternatively spliced transcript variants have been described.[provided by RefSeq, Feb 2010]

Allele List at MGI

Other mutations in this stock

Total: 57 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
6430573F11Rik	T	C	8: 36,511,924	I227T	probably benign	Het
6820408C15Rik	C	G	2: 152,440,857	P211A	probably damaging	Het
Ambra1	G	A	2: 91,885,606	V761M	probably damaging	Het
Amfr	T	A	8: 93,976,170		probably null	Het
Asphd1	C	A	7: 126,946,115	A357S	probably benign	Het
Brd3	C	A	2: 27,463,919	Q60H	probably damaging	Het
Cd96	T	A	16: 46,069,653	M336L	probably benign	Het
Cep152	T	A	2: 125,564,205	H1469L	probably benign	Het
Coro1a	G	T	7: 126,700,644		probably null	Het
D630045J12Rik	A	T	6: 38,194,620	L871Q	probably benign	Het
Depdc5	C	T	5: 32,938,291	P824L	probably damaging	Het
Enpep	T	G	3: 129,305,426	D467A	probably damaging	Het
Extl2	G	A	3: 116,027,364	A273T	probably benign	Het
Foxi3	T	A	6: 70,960,516	F218Y	probably damaging	Het
Golga2	A	G	2: 32,304,154	M521V	probably benign	Het
Gpr142	T	A	11: 114,804,342	N44K	probably damaging	Het
Gtf2ird2	A	G	5: 134,216,219	I440V	probably benign	Het
Gucy1b2	T	A	14: 62,404,579	K698I	probably damaging	Het
Hspa1b	T	C	17: 34,959,007	M1V	probably null	Het
Khdc3	T	G	9: 73,103,486	V182G	possibly damaging	Het
Ky	A	G	9: 102,537,599		probably null	Het
Map2k1	T	A	9: 64,191,561	I263F	probably damaging	Het
Olfr328	T	C	11: 58,552,051	S63G	probably benign	Het
Olfr46	A	C	7: 140,610,663	I166L	probably benign	Het
Olfr995	A	G	2: 85,438,897	V87A	probably benign	Het
Otogl	T	A	10: 107,777,592	H2004L	probably benign	Het
Palmd	T	C	3: 116,923,360	H496R	probably benign	Het
Papolb	C	G	5: 142,529,654	R78P	possibly damaging	Het
Pcdh10	G	A	3: 45,381,812	G854R	probably damaging	Het
Pdcd11	A	G	19: 47,113,537	I1054V	probably benign	Het
Pik3ap1	A	T	19: 41,376,106	L58Q	probably damaging	Het
Ppp2ca	A	G	11: 52,099,110	K21R	probably benign	Het
Prmt5	A	C	14: 54,507,916	I598S	probably damaging	Het
Pycr1	T	A	11: 120,641,224	I239F	probably damaging	Het
R3hdm2	C	T	10: 127,498,416	R896C	probably damaging	Het
Rev3l	C	T	10: 39,846,729	P699S	probably damaging	Het
Samd1	CGAGGAGGAGGAGGAGGAGGA	CGAGGAGGAGGAGGAGGA	8: 83,998,996		probably benign	Het
Sel1l	A	T	12: 91,824,884	M351K	possibly damaging	Het
Sesn2	A	G	4: 132,499,306	L159P	probably damaging	Het
Slc35f4	T	A	14: 49,303,489		probably benign	Het
Slc3a1	C	A	17: 85,051,975	N409K	probably damaging	Het
Slc45a2	C	T	15: 11,027,785	T480I	probably damaging	Het
Slco1c1	T	C	6: 141,546,776	F246S	probably damaging	Het
Socs2	T	G	10: 95,392,819	I190L	unknown	Het
Srsf1	T	A	11: 88,047,858	I7N	possibly damaging	Het
Stox1	T	A	10: 62,667,841	H145L	probably damaging	Het
Trap1	A	T	16: 4,056,422	I243N	probably damaging	Het
Trav7-3	T	C	14: 53,443,750	I83T	probably benign	Het
Tuft1	A	T	3: 94,639,405	I42K	possibly damaging	Het
Umps	A	G	16: 33,966,974	V3A	probably benign	Het
Vim	A	C	2: 13,574,832	E134A	probably null	Het
Vmn1r28	C	A	6: 58,265,539	H122Q	probably benign	Het
Vps51	T	G	19: 6,071,033	E283D	probably benign	Het
Vsig10l	T	A	7: 43,470,850	V760D	probably damaging	Het
Xrn1	A	G	9: 96,045,543	D1460G	probably benign	Het
Zfp282	A	G	6: 47,897,890	D343G	probably damaging	Het
Zfp35	A	G	18: 24,003,721	H374R	probably damaging	Het

Other mutations in Ints9

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01143:Ints9	APN	14	65037421	missense	probably benign	0.00
IGL02374:Ints9	APN	14	65039333	missense	probably benign	0.00
IGL02728:Ints9	APN	14	64993008	missense	probably damaging	1.00
IGL02992:Ints9	APN	14	64980164	missense	probably benign	0.08
IGL03151:Ints9	APN	14	65032340	missense	possibly damaging	0.86
R0437:Ints9	UTSW	14	64986369	splice site	probably benign
R0582:Ints9	UTSW	14	64980149	missense	probably damaging	1.00
R1525:Ints9	UTSW	14	64995011	missense	probably benign	0.05
R1569:Ints9	UTSW	14	64980122	missense	possibly damaging	0.91
R1835:Ints9	UTSW	14	65032256	missense	probably damaging	1.00
R1839:Ints9	UTSW	14	65016530	missense	probably damaging	1.00
R1862:Ints9	UTSW	14	65026413	missense	probably benign
R1892:Ints9	UTSW	14	65020423	missense	probably benign	0.08
R2146:Ints9	UTSW	14	64986343	missense	possibly damaging	0.71
R2285:Ints9	UTSW	14	65007997	missense	possibly damaging	0.61
R3015:Ints9	UTSW	14	64950278	missense	probably benign	0.00
R4133:Ints9	UTSW	14	64990554	missense	probably benign
R4180:Ints9	UTSW	14	64992981	missense	probably damaging	1.00
R4509:Ints9	UTSW	14	65028932	missense	possibly damaging	0.96
R4510:Ints9	UTSW	14	65028932	missense	possibly damaging	0.96
R4511:Ints9	UTSW	14	65028932	missense	possibly damaging	0.96
R4608:Ints9	UTSW	14	65032280	missense	possibly damaging	0.82
R5023:Ints9	UTSW	14	64980228	missense	probably damaging	1.00
R5117:Ints9	UTSW	14	64993091	nonsense	probably null
R5582:Ints9	UTSW	14	65028896	missense	possibly damaging	0.83
R5990:Ints9	UTSW	14	65039328	missense	probably damaging	1.00
R6009:Ints9	UTSW	14	65008082	missense	probably benign	0.43
R6241:Ints9	UTSW	14	64980210	missense	possibly damaging	0.90
R6351:Ints9	UTSW	14	64993007	missense	probably damaging	0.98
R6821:Ints9	UTSW	14	65037458	missense	probably benign	0.20
R7422:Ints9	UTSW	14	65032298	missense	possibly damaging	0.93
R7442:Ints9	UTSW	14	64995064	nonsense	probably null
R7475:Ints9	UTSW	14	65026465	missense	probably null	0.23
R8183:Ints9	UTSW	14	65036453	missense	probably damaging	0.98
R8223:Ints9	UTSW	14	65020360	missense	possibly damaging	0.94
R8282:Ints9	UTSW	14	65007308	missense	probably benign	0.00
R8314:Ints9	UTSW	14	65029030	missense	probably damaging	1.00
R8341:Ints9	UTSW	14	65036414	missense	probably benign	0.14
R8548:Ints9	UTSW	14	65032321	missense	probably benign	0.39
R9356:Ints9	UTSW	14	65032321	missense	probably benign	0.39
R9434:Ints9	UTSW	14	65008057	missense	probably benign	0.00
Z1176:Ints9	UTSW	14	65037454	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- TCTGTTACAGCACAGCCACC -3'
(R):5'- ACGCACTCGCCTAGACTATC -3'

Sequencing Primer
(F):5'- ACAGCCACCATCATTCTGTCTG -3'
(R):5'- ACTCGCCTAGACTATCTAAGATCTAG -3'

Posted On

2016-07-06