Incidental Mutation 'R5262:Maip1'
ID401474
Institutional Source Beutler Lab
Gene Symbol Maip1
Ensembl Gene ENSMUSG00000025971
Gene Namematrix AAA peptidase interacting protein 1
Synonyms9430016H08Rik
MMRRC Submission 042857-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.106) question?
Stock #R5262 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location57406328-57417953 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 57406972 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 67 (R67H)
Ref Sequence ENSEMBL: ENSMUSP00000027114 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027114] [ENSMUST00000079998] [ENSMUST00000160118] [ENSMUST00000160837] [ENSMUST00000162686]
Predicted Effect probably damaging
Transcript: ENSMUST00000027114
AA Change: R67H

PolyPhen 2 Score 0.960 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000027114
Gene: ENSMUSG00000025971
AA Change: R67H

DomainStartEndE-ValueType
low complexity region 2 18 N/A INTRINSIC
low complexity region 66 78 N/A INTRINSIC
low complexity region 82 93 N/A INTRINSIC
low complexity region 98 109 N/A INTRINSIC
Blast:Tim44 131 210 3e-11 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000079998
SMART Domains Protein: ENSMUSP00000078912
Gene: ENSMUSG00000048495

DomainStartEndE-ValueType
PDB:3AL6|D 1 71 3e-39 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000097732
Predicted Effect probably benign
Transcript: ENSMUST00000160118
SMART Domains Protein: ENSMUSP00000125386
Gene: ENSMUSG00000048495

DomainStartEndE-ValueType
PDB:3AL6|D 1 71 1e-38 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000160837
SMART Domains Protein: ENSMUSP00000128576
Gene: ENSMUSG00000048495

DomainStartEndE-ValueType
JmjC 103 255 2.25e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161780
SMART Domains Protein: ENSMUSP00000125487
Gene: ENSMUSG00000048495

DomainStartEndE-ValueType
PDB:3AL6|D 1 71 3e-39 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000162686
SMART Domains Protein: ENSMUSP00000125427
Gene: ENSMUSG00000048495

DomainStartEndE-ValueType
JmjC 105 265 5.8e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185709
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.5%
Validation Efficiency 98% (61/62)
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ago4 T A 4: 126,496,764 D821V possibly damaging Het
Ankdd1b C A 13: 96,420,773 R384L probably damaging Het
Ces1e A G 8: 93,223,958 F65S probably damaging Het
Cfap53 A C 18: 74,329,459 S425R probably benign Het
Corin A G 5: 72,304,955 V837A probably damaging Het
Cyp2d34 A T 15: 82,618,371 V188E probably damaging Het
Defb26 A T 2: 152,507,958 M134K unknown Het
Dnah10 A C 5: 124,785,156 K2158N probably damaging Het
Dnah9 C T 11: 66,112,333 V882M probably benign Het
Dpyd C A 3: 118,797,422 Y186* probably null Het
Elovl1 G A 4: 118,430,927 probably benign Het
Fars2 T A 13: 36,342,018 I329N probably damaging Het
Gstm1 T A 3: 108,016,363 M109L probably benign Het
Gtf2e1 T C 16: 37,535,931 T80A probably damaging Het
Gtf2h2 A G 13: 100,481,848 probably benign Het
Hrh4 G T 18: 13,015,813 L77F probably damaging Het
Ifi47 A G 11: 49,095,732 T109A probably benign Het
Igsf5 G T 16: 96,391,037 E179* probably null Het
Ints8 A G 4: 11,211,916 I885T probably damaging Het
Iqgap1 T G 7: 80,726,742 I1341L probably benign Het
Kmt2b A G 7: 30,569,794 L2567P probably damaging Het
Lilrb4a T C 10: 51,493,207 probably null Het
Muc6 T A 7: 141,651,110 I254F possibly damaging Het
Nfkb1 A T 3: 135,612,412 probably null Het
Nlrp4a T C 7: 26,459,811 probably null Het
Nrap A T 19: 56,320,223 I1477N possibly damaging Het
Pdgfa A G 5: 138,993,294 S52P probably benign Het
Pou1f1 G T 16: 65,531,982 E196* probably null Het
Ppp2r5e G A 12: 75,593,271 R19W probably damaging Het
Ptn T A 6: 36,744,484 Q7L probably benign Het
Rbp3 G T 14: 33,954,850 A252S probably damaging Het
Rcor2 G T 19: 7,274,061 V313L probably damaging Het
Rtp3 A T 9: 110,986,127 probably benign Het
Ryr2 T C 13: 11,772,437 T1017A probably damaging Het
Scgb2b11 T C 7: 32,209,351 N108S probably benign Het
Sgo2b C A 8: 63,943,137 L28F probably damaging Het
Shroom3 A G 5: 92,964,573 E1850G probably damaging Het
Slc16a14 A G 1: 84,912,891 L231P probably benign Het
Slfn5 A G 11: 82,956,670 E127G possibly damaging Het
Snx16 C T 3: 10,437,832 M118I probably damaging Het
Snx21 T C 2: 164,791,821 F176L probably damaging Het
Tap2 A G 17: 34,214,016 N424S probably benign Het
Tcf7l1 T C 6: 72,636,466 probably benign Het
Trappc8 C T 18: 20,818,190 V1400I probably benign Het
Trim58 T C 11: 58,651,668 Y485H possibly damaging Het
U2af1l4 C T 7: 30,564,213 T65I probably benign Het
Ufl1 G T 4: 25,251,294 probably benign Het
Usp8 A G 2: 126,751,111 N762S probably damaging Het
Virma A T 4: 11,539,926 D1465V probably benign Het
Vmn1r48 A T 6: 90,036,034 S270T probably benign Het
Vrk2 T A 11: 26,591,697 Y9F possibly damaging Het
Wwp1 A G 4: 19,631,057 F659L probably damaging Het
Zbtb24 C T 10: 41,464,560 Q529* probably null Het
Zranb1 CTGATGATGATG CTGATGATGATGATG 7: 132,982,827 probably benign Het
Other mutations in Maip1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02732:Maip1 APN 1 57409955 missense probably damaging 1.00
IGL03064:Maip1 APN 1 57407200 missense probably damaging 1.00
R0403:Maip1 UTSW 1 57407196 missense probably benign 0.14
R0411:Maip1 UTSW 1 57415693 missense probably damaging 1.00
R0732:Maip1 UTSW 1 57411835 missense probably damaging 1.00
R1569:Maip1 UTSW 1 57413395 splice site probably benign
R1620:Maip1 UTSW 1 57409985 critical splice donor site probably null
R2830:Maip1 UTSW 1 57415663 missense possibly damaging 0.53
R4574:Maip1 UTSW 1 57413245 missense possibly damaging 0.90
R4605:Maip1 UTSW 1 57411732 missense probably benign 0.00
R5082:Maip1 UTSW 1 57411851 critical splice donor site probably null
R5178:Maip1 UTSW 1 57415690 missense probably benign 0.06
R5883:Maip1 UTSW 1 57407101 missense probably damaging 0.99
R6837:Maip1 UTSW 1 57415732 makesense probably null
R7445:Maip1 UTSW 1 57407031 missense possibly damaging 0.79
R7687:Maip1 UTSW 1 57411844 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- AGGTCACAAACATGGCGCTG -3'
(R):5'- TAAGGAAGGCGTAAATTCGAGTCC -3'

Sequencing Primer
(F):5'- GGCCGCCCGTCTCCTAC -3'
(R):5'- TAAATTCGAGTCCGGACCCAGTTG -3'
Posted On2016-07-06