Incidental Mutation 'R5262:Snx21'
ID401480
Institutional Source Beutler Lab
Gene Symbol Snx21
Ensembl Gene ENSMUSG00000050373
Gene Namesorting nexin family member 21
Synonyms
MMRRC Submission 042857-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5262 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location164785823-164793816 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 164791821 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 176 (F176L)
Ref Sequence ENSEMBL: ENSMUSP00000054137 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000017451] [ENSMUST00000056181] [ENSMUST00000103094] [ENSMUST00000134611] [ENSMUST00000152471] [ENSMUST00000172577] [ENSMUST00000174070]
Predicted Effect probably benign
Transcript: ENSMUST00000017451
SMART Domains Protein: ENSMUSP00000017451
Gene: ENSMUSG00000017307

DomainStartEndE-ValueType
Pfam:Acyl_CoA_thio 38 132 4.6e-9 PFAM
Pfam:4HBT_3 45 255 8.8e-30 PFAM
Pfam:Acyl_CoA_thio 180 253 2.8e-8 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000056181
AA Change: F176L

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000054137
Gene: ENSMUSG00000050373
AA Change: F176L

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
low complexity region 17 28 N/A INTRINSIC
low complexity region 58 69 N/A INTRINSIC
low complexity region 95 106 N/A INTRINSIC
PX 124 232 4.19e-10 SMART
low complexity region 249 263 N/A INTRINSIC
low complexity region 334 343 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000103094
SMART Domains Protein: ENSMUSP00000099383
Gene: ENSMUSG00000017307

DomainStartEndE-ValueType
Pfam:Acyl_CoA_thio 39 132 5e-9 PFAM
Pfam:4HBT_3 45 309 2.7e-44 PFAM
Pfam:Acyl_CoA_thio 180 308 5.3e-30 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133053
Predicted Effect probably benign
Transcript: ENSMUST00000134611
SMART Domains Protein: ENSMUSP00000133718
Gene: ENSMUSG00000017307

DomainStartEndE-ValueType
low complexity region 79 113 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000140519
Predicted Effect probably benign
Transcript: ENSMUST00000152471
SMART Domains Protein: ENSMUSP00000133914
Gene: ENSMUSG00000050373

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
low complexity region 17 28 N/A INTRINSIC
low complexity region 58 69 N/A INTRINSIC
low complexity region 95 106 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000172577
SMART Domains Protein: ENSMUSP00000134133
Gene: ENSMUSG00000050373

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
low complexity region 17 28 N/A INTRINSIC
low complexity region 58 69 N/A INTRINSIC
low complexity region 95 106 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173945
Predicted Effect probably benign
Transcript: ENSMUST00000174070
SMART Domains Protein: ENSMUSP00000133344
Gene: ENSMUSG00000050373

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
low complexity region 17 28 N/A INTRINSIC
low complexity region 58 69 N/A INTRINSIC
low complexity region 95 106 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174342
Meta Mutation Damage Score 0.4608 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.5%
Validation Efficiency 98% (61/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the sorting nexin family. Members of this family contain a phox (PX) domain, which is a phosphoinositide binding domain, and are involved in intracellular trafficking. This protein does not contain a coiled coil region, like some family members. The specific function of this protein has not been determined. Multiple transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ago4 T A 4: 126,496,764 D821V possibly damaging Het
Ankdd1b C A 13: 96,420,773 R384L probably damaging Het
Ces1e A G 8: 93,223,958 F65S probably damaging Het
Cfap53 A C 18: 74,329,459 S425R probably benign Het
Corin A G 5: 72,304,955 V837A probably damaging Het
Cyp2d34 A T 15: 82,618,371 V188E probably damaging Het
Defb26 A T 2: 152,507,958 M134K unknown Het
Dnah10 A C 5: 124,785,156 K2158N probably damaging Het
Dnah9 C T 11: 66,112,333 V882M probably benign Het
Dpyd C A 3: 118,797,422 Y186* probably null Het
Elovl1 G A 4: 118,430,927 probably benign Het
Fars2 T A 13: 36,342,018 I329N probably damaging Het
Gstm1 T A 3: 108,016,363 M109L probably benign Het
Gtf2e1 T C 16: 37,535,931 T80A probably damaging Het
Gtf2h2 A G 13: 100,481,848 probably benign Het
Hrh4 G T 18: 13,015,813 L77F probably damaging Het
Ifi47 A G 11: 49,095,732 T109A probably benign Het
Igsf5 G T 16: 96,391,037 E179* probably null Het
Ints8 A G 4: 11,211,916 I885T probably damaging Het
Iqgap1 T G 7: 80,726,742 I1341L probably benign Het
Kmt2b A G 7: 30,569,794 L2567P probably damaging Het
Lilrb4a T C 10: 51,493,207 probably null Het
Maip1 G A 1: 57,406,972 R67H probably damaging Het
Muc6 T A 7: 141,651,110 I254F possibly damaging Het
Nfkb1 A T 3: 135,612,412 probably null Het
Nlrp4a T C 7: 26,459,811 probably null Het
Nrap A T 19: 56,320,223 I1477N possibly damaging Het
Pdgfa A G 5: 138,993,294 S52P probably benign Het
Pou1f1 G T 16: 65,531,982 E196* probably null Het
Ppp2r5e G A 12: 75,593,271 R19W probably damaging Het
Ptn T A 6: 36,744,484 Q7L probably benign Het
Rbp3 G T 14: 33,954,850 A252S probably damaging Het
Rcor2 G T 19: 7,274,061 V313L probably damaging Het
Rtp3 A T 9: 110,986,127 probably benign Het
Ryr2 T C 13: 11,772,437 T1017A probably damaging Het
Scgb2b11 T C 7: 32,209,351 N108S probably benign Het
Sgo2b C A 8: 63,943,137 L28F probably damaging Het
Shroom3 A G 5: 92,964,573 E1850G probably damaging Het
Slc16a14 A G 1: 84,912,891 L231P probably benign Het
Slfn5 A G 11: 82,956,670 E127G possibly damaging Het
Snx16 C T 3: 10,437,832 M118I probably damaging Het
Tap2 A G 17: 34,214,016 N424S probably benign Het
Tcf7l1 T C 6: 72,636,466 probably benign Het
Trappc8 C T 18: 20,818,190 V1400I probably benign Het
Trim58 T C 11: 58,651,668 Y485H possibly damaging Het
U2af1l4 C T 7: 30,564,213 T65I probably benign Het
Ufl1 G T 4: 25,251,294 probably benign Het
Usp8 A G 2: 126,751,111 N762S probably damaging Het
Virma A T 4: 11,539,926 D1465V probably benign Het
Vmn1r48 A T 6: 90,036,034 S270T probably benign Het
Vrk2 T A 11: 26,591,697 Y9F possibly damaging Het
Wwp1 A G 4: 19,631,057 F659L probably damaging Het
Zbtb24 C T 10: 41,464,560 Q529* probably null Het
Zranb1 CTGATGATGATG CTGATGATGATGATG 7: 132,982,827 probably benign Het
Other mutations in Snx21
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00906:Snx21 APN 2 164786220 missense probably damaging 1.00
IGL02329:Snx21 APN 2 164792390 utr 3 prime probably benign
R4162:Snx21 UTSW 2 164786850 missense probably damaging 1.00
R4164:Snx21 UTSW 2 164786850 missense probably damaging 1.00
R5092:Snx21 UTSW 2 164786746 missense probably damaging 0.99
R6875:Snx21 UTSW 2 164791902 missense probably damaging 1.00
R7231:Snx21 UTSW 2 164786201 missense probably benign 0.00
R7757:Snx21 UTSW 2 164786165 missense probably damaging 1.00
R8001:Snx21 UTSW 2 164786737 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- TTCCTCCTAGCCAGTCTCAGAAG -3'
(R):5'- TCGGGCAGCACAAAGAAGTC -3'

Sequencing Primer
(F):5'- TCCTAGCCAGTCTCAGAAGAGGTG -3'
(R):5'- CAAAGAAGTCCTGCAGGTCCG -3'
Posted On2016-07-06