Incidental Mutation 'R5262:Nlrp4a'
ID 401498
Institutional Source Beutler Lab
Gene Symbol Nlrp4a
Ensembl Gene ENSMUSG00000040601
Gene Name NLR family, pyrin domain containing 4A
Synonyms Nalp-eta, E330028A19Rik, Nalp4a
MMRRC Submission 042857-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.079) question?
Stock # R5262 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 26134538-26175100 bp(+) (GRCm39)
Type of Mutation critical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 26159236 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000146044 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068767] [ENSMUST00000119386] [ENSMUST00000146907]
AlphaFold Q8BU40
Predicted Effect probably null
Transcript: ENSMUST00000068767
SMART Domains Protein: ENSMUSP00000066841
Gene: ENSMUSG00000040601

DomainStartEndE-ValueType
PYRIN 6 89 6.48e-34 SMART
Pfam:NACHT 148 317 4.9e-37 PFAM
Blast:LRR 634 661 4e-6 BLAST
low complexity region 666 677 N/A INTRINSIC
LRR 689 716 5.96e0 SMART
LRR 718 745 1.99e1 SMART
LRR 746 772 1.02e0 SMART
LRR 774 801 4.66e1 SMART
LRR 802 829 1.18e-2 SMART
LRR 831 858 2.2e-2 SMART
LRR 859 886 5.59e-4 SMART
LRR 888 915 9.41e0 SMART
LRR 916 943 8.94e1 SMART
Predicted Effect probably null
Transcript: ENSMUST00000119386
SMART Domains Protein: ENSMUSP00000112441
Gene: ENSMUSG00000040601

DomainStartEndE-ValueType
PYRIN 6 89 6.48e-34 SMART
Pfam:NACHT 148 317 1.3e-37 PFAM
Blast:LRR 634 661 4e-6 BLAST
low complexity region 666 677 N/A INTRINSIC
LRR 689 716 5.96e0 SMART
LRR 718 745 1.99e1 SMART
LRR 746 772 1.02e0 SMART
LRR 774 801 4.66e1 SMART
LRR 802 829 1.18e-2 SMART
LRR 831 858 2.2e-2 SMART
LRR 859 886 5.59e-4 SMART
LRR 888 915 9.41e0 SMART
LRR 916 943 8.94e1 SMART
Predicted Effect probably null
Transcript: ENSMUST00000146907
Meta Mutation Damage Score 0.9484 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.5%
Validation Efficiency 98% (61/62)
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ago4 T A 4: 126,390,557 (GRCm39) D821V possibly damaging Het
Ankdd1b C A 13: 96,557,281 (GRCm39) R384L probably damaging Het
Ces1e A G 8: 93,950,586 (GRCm39) F65S probably damaging Het
Cfap53 A C 18: 74,462,530 (GRCm39) S425R probably benign Het
Corin A G 5: 72,462,298 (GRCm39) V837A probably damaging Het
Cyp2d34 A T 15: 82,502,572 (GRCm39) V188E probably damaging Het
Defb26 A T 2: 152,349,878 (GRCm39) M134K unknown Het
Dnah10 A C 5: 124,862,220 (GRCm39) K2158N probably damaging Het
Dnah9 C T 11: 66,003,159 (GRCm39) V882M probably benign Het
Dpyd C A 3: 118,591,071 (GRCm39) Y186* probably null Het
Elovl1 G A 4: 118,288,124 (GRCm39) probably benign Het
Fars2 T A 13: 36,526,001 (GRCm39) I329N probably damaging Het
Gstm1 T A 3: 107,923,679 (GRCm39) M109L probably benign Het
Gtf2e1 T C 16: 37,356,293 (GRCm39) T80A probably damaging Het
Gtf2h2 A G 13: 100,618,356 (GRCm39) probably benign Het
Hrh4 G T 18: 13,148,870 (GRCm39) L77F probably damaging Het
Ifi47 A G 11: 48,986,559 (GRCm39) T109A probably benign Het
Igsf5 G T 16: 96,192,237 (GRCm39) E179* probably null Het
Ints8 A G 4: 11,211,916 (GRCm39) I885T probably damaging Het
Iqgap1 T G 7: 80,376,490 (GRCm39) I1341L probably benign Het
Kmt2b A G 7: 30,269,219 (GRCm39) L2567P probably damaging Het
Lilrb4a T C 10: 51,369,303 (GRCm39) probably null Het
Maip1 G A 1: 57,446,131 (GRCm39) R67H probably damaging Het
Muc6 T A 7: 141,237,375 (GRCm39) I254F possibly damaging Het
Nfkb1 A T 3: 135,318,173 (GRCm39) probably null Het
Nrap A T 19: 56,308,655 (GRCm39) I1477N possibly damaging Het
Pdgfa A G 5: 138,979,049 (GRCm39) S52P probably benign Het
Pou1f1 G T 16: 65,328,868 (GRCm39) E196* probably null Het
Ppp2r5e G A 12: 75,640,045 (GRCm39) R19W probably damaging Het
Ptn T A 6: 36,721,419 (GRCm39) Q7L probably benign Het
Rbp3 G T 14: 33,676,807 (GRCm39) A252S probably damaging Het
Rcor2 G T 19: 7,251,426 (GRCm39) V313L probably damaging Het
Rtp3 A T 9: 110,815,195 (GRCm39) probably benign Het
Ryr2 T C 13: 11,787,323 (GRCm39) T1017A probably damaging Het
Scgb2b11 T C 7: 31,908,776 (GRCm39) N108S probably benign Het
Sgo2b C A 8: 64,396,171 (GRCm39) L28F probably damaging Het
Shroom3 A G 5: 93,112,432 (GRCm39) E1850G probably damaging Het
Slc16a14 A G 1: 84,890,612 (GRCm39) L231P probably benign Het
Slfn5 A G 11: 82,847,496 (GRCm39) E127G possibly damaging Het
Snx16 C T 3: 10,502,892 (GRCm39) M118I probably damaging Het
Snx21 T C 2: 164,633,741 (GRCm39) F176L probably damaging Het
Tap2 A G 17: 34,432,990 (GRCm39) N424S probably benign Het
Tcf7l1 T C 6: 72,613,449 (GRCm39) probably benign Het
Trappc8 C T 18: 20,951,247 (GRCm39) V1400I probably benign Het
Trim58 T C 11: 58,542,494 (GRCm39) Y485H possibly damaging Het
U2af1l4 C T 7: 30,263,638 (GRCm39) T65I probably benign Het
Ufl1 G T 4: 25,251,294 (GRCm39) probably benign Het
Usp8 A G 2: 126,593,031 (GRCm39) N762S probably damaging Het
Virma A T 4: 11,539,926 (GRCm39) D1465V probably benign Het
Vmn1r48 A T 6: 90,013,016 (GRCm39) S270T probably benign Het
Vrk2 T A 11: 26,541,697 (GRCm39) Y9F possibly damaging Het
Wwp1 A G 4: 19,631,057 (GRCm39) F659L probably damaging Het
Zbtb24 C T 10: 41,340,556 (GRCm39) Q529* probably null Het
Zranb1 CTGATGATGATG CTGATGATGATGATG 7: 132,584,556 (GRCm39) probably benign Het
Other mutations in Nlrp4a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00487:Nlrp4a APN 7 26,149,410 (GRCm39) missense possibly damaging 0.51
IGL00972:Nlrp4a APN 7 26,156,473 (GRCm39) missense probably benign
IGL01081:Nlrp4a APN 7 26,149,254 (GRCm39) missense probably benign 0.06
IGL01788:Nlrp4a APN 7 26,153,492 (GRCm39) missense probably benign 0.17
IGL02001:Nlrp4a APN 7 26,149,394 (GRCm39) missense probably benign 0.01
IGL02070:Nlrp4a APN 7 26,148,703 (GRCm39) missense possibly damaging 0.77
IGL02175:Nlrp4a APN 7 26,174,522 (GRCm39) missense probably damaging 1.00
IGL02193:Nlrp4a APN 7 26,148,703 (GRCm39) missense possibly damaging 0.77
IGL02193:Nlrp4a APN 7 26,159,117 (GRCm39) missense probably damaging 1.00
IGL02197:Nlrp4a APN 7 26,148,703 (GRCm39) missense possibly damaging 0.77
IGL02200:Nlrp4a APN 7 26,148,703 (GRCm39) missense possibly damaging 0.77
IGL02202:Nlrp4a APN 7 26,148,703 (GRCm39) missense possibly damaging 0.77
IGL02207:Nlrp4a APN 7 26,148,703 (GRCm39) missense possibly damaging 0.77
IGL02237:Nlrp4a APN 7 26,148,703 (GRCm39) missense possibly damaging 0.77
IGL02240:Nlrp4a APN 7 26,148,703 (GRCm39) missense possibly damaging 0.77
IGL02658:Nlrp4a APN 7 26,149,138 (GRCm39) missense probably benign 0.43
IGL02743:Nlrp4a APN 7 26,159,240 (GRCm39) splice site probably benign
IGL02960:Nlrp4a APN 7 26,149,155 (GRCm39) missense probably benign 0.05
IGL03064:Nlrp4a APN 7 26,148,934 (GRCm39) missense probably benign 0.23
IGL03276:Nlrp4a APN 7 26,163,615 (GRCm39) missense probably damaging 1.00
BB002:Nlrp4a UTSW 7 26,150,011 (GRCm39) missense probably benign 0.10
BB012:Nlrp4a UTSW 7 26,150,011 (GRCm39) missense probably benign 0.10
D3080:Nlrp4a UTSW 7 26,143,766 (GRCm39) missense probably benign 0.22
P0019:Nlrp4a UTSW 7 26,149,062 (GRCm39) missense probably damaging 1.00
R0020:Nlrp4a UTSW 7 26,149,797 (GRCm39) missense probably damaging 1.00
R0240:Nlrp4a UTSW 7 26,161,941 (GRCm39) missense probably benign 0.00
R0240:Nlrp4a UTSW 7 26,161,941 (GRCm39) missense probably benign 0.00
R0372:Nlrp4a UTSW 7 26,148,657 (GRCm39) splice site probably benign
R0466:Nlrp4a UTSW 7 26,162,045 (GRCm39) splice site probably benign
R0544:Nlrp4a UTSW 7 26,156,555 (GRCm39) missense probably benign 0.00
R1006:Nlrp4a UTSW 7 26,152,892 (GRCm39) missense probably benign 0.30
R1072:Nlrp4a UTSW 7 26,143,860 (GRCm39) missense probably damaging 1.00
R1432:Nlrp4a UTSW 7 26,163,622 (GRCm39) frame shift probably null
R1655:Nlrp4a UTSW 7 26,149,076 (GRCm39) missense possibly damaging 0.56
R1696:Nlrp4a UTSW 7 26,149,959 (GRCm39) missense probably damaging 1.00
R2041:Nlrp4a UTSW 7 26,149,611 (GRCm39) missense probably damaging 0.97
R2091:Nlrp4a UTSW 7 26,149,578 (GRCm39) missense probably damaging 1.00
R2163:Nlrp4a UTSW 7 26,152,822 (GRCm39) missense probably benign 0.00
R2174:Nlrp4a UTSW 7 26,148,849 (GRCm39) missense probably damaging 1.00
R2319:Nlrp4a UTSW 7 26,149,319 (GRCm39) missense probably benign 0.10
R2358:Nlrp4a UTSW 7 26,163,623 (GRCm39) missense probably benign 0.03
R2680:Nlrp4a UTSW 7 26,148,655 (GRCm39) splice site probably null
R3812:Nlrp4a UTSW 7 26,149,118 (GRCm39) missense probably benign
R4114:Nlrp4a UTSW 7 26,149,365 (GRCm39) missense probably damaging 1.00
R4664:Nlrp4a UTSW 7 26,148,943 (GRCm39) nonsense probably null
R4676:Nlrp4a UTSW 7 26,149,654 (GRCm39) missense probably damaging 1.00
R4708:Nlrp4a UTSW 7 26,163,533 (GRCm39) missense probably benign 0.00
R4728:Nlrp4a UTSW 7 26,174,515 (GRCm39) missense probably benign 0.24
R4815:Nlrp4a UTSW 7 26,150,233 (GRCm39) missense probably benign 0.00
R4831:Nlrp4a UTSW 7 26,149,844 (GRCm39) missense possibly damaging 0.92
R5007:Nlrp4a UTSW 7 26,161,905 (GRCm39) missense probably damaging 0.99
R5253:Nlrp4a UTSW 7 26,149,917 (GRCm39) missense probably benign 0.00
R5441:Nlrp4a UTSW 7 26,153,578 (GRCm39) missense probably damaging 1.00
R5639:Nlrp4a UTSW 7 26,156,455 (GRCm39) missense probably benign 0.02
R5641:Nlrp4a UTSW 7 26,149,589 (GRCm39) missense probably damaging 1.00
R5771:Nlrp4a UTSW 7 26,152,814 (GRCm39) missense probably damaging 1.00
R6312:Nlrp4a UTSW 7 26,148,821 (GRCm39) missense probably benign 0.11
R7131:Nlrp4a UTSW 7 26,149,258 (GRCm39) missense probably benign 0.21
R7149:Nlrp4a UTSW 7 26,149,863 (GRCm39) missense probably benign 0.00
R7348:Nlrp4a UTSW 7 26,143,698 (GRCm39) missense probably damaging 1.00
R7384:Nlrp4a UTSW 7 26,148,963 (GRCm39) missense not run
R7548:Nlrp4a UTSW 7 26,149,604 (GRCm39) missense probably damaging 1.00
R7566:Nlrp4a UTSW 7 26,148,670 (GRCm39) critical splice acceptor site probably null
R7646:Nlrp4a UTSW 7 26,148,987 (GRCm39) missense probably damaging 0.96
R7692:Nlrp4a UTSW 7 26,148,690 (GRCm39) missense probably benign 0.01
R7902:Nlrp4a UTSW 7 26,149,482 (GRCm39) missense possibly damaging 0.65
R7925:Nlrp4a UTSW 7 26,150,011 (GRCm39) missense probably benign 0.10
R7937:Nlrp4a UTSW 7 26,163,571 (GRCm39) missense probably benign 0.00
R7992:Nlrp4a UTSW 7 26,150,070 (GRCm39) missense possibly damaging 0.51
R8205:Nlrp4a UTSW 7 26,150,219 (GRCm39) missense probably benign
R8477:Nlrp4a UTSW 7 26,159,219 (GRCm39) missense probably benign
R8704:Nlrp4a UTSW 7 26,156,563 (GRCm39) missense probably benign 0.02
R8791:Nlrp4a UTSW 7 26,143,561 (GRCm39) splice site probably benign
R9220:Nlrp4a UTSW 7 26,149,523 (GRCm39) missense probably damaging 0.97
R9332:Nlrp4a UTSW 7 26,159,077 (GRCm39) missense probably damaging 0.99
T0975:Nlrp4a UTSW 7 26,149,062 (GRCm39) missense probably damaging 1.00
X0022:Nlrp4a UTSW 7 26,143,767 (GRCm39) missense probably damaging 0.99
Z1088:Nlrp4a UTSW 7 26,153,588 (GRCm39) missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TACCCCTACAGTTTGGCCAAC -3'
(R):5'- GACTCAAGCCATGATTCCTTTC -3'

Sequencing Primer
(F):5'- CTGCTCCCTCAATGAGAAATGCTG -3'
(R):5'- GTGTCTATAGTCCAAGTGGGTGCC -3'
Posted On 2016-07-06