Incidental Mutation 'R5262:U2af1l4'
ID401499
Institutional Source Beutler Lab
Gene Symbol U2af1l4
Ensembl Gene ENSMUSG00000078765
Gene NameU2 small nuclear RNA auxiliary factor 1-like 4
Synonymsauxiliary factor 26, U2af26
MMRRC Submission 042857-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.343) question?
Stock #R5262 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location30563301-30565365 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 30564213 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 65 (T65I)
Ref Sequence ENSEMBL: ENSMUSP00000146344 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006470] [ENSMUST00000043273] [ENSMUST00000043850] [ENSMUST00000043898] [ENSMUST00000043975] [ENSMUST00000108154] [ENSMUST00000108161] [ENSMUST00000108164] [ENSMUST00000156241] [ENSMUST00000163276] [ENSMUST00000163330] [ENSMUST00000163464] [ENSMUST00000163482] [ENSMUST00000163654] [ENSMUST00000163848] [ENSMUST00000164365] [ENSMUST00000166257] [ENSMUST00000166510] [ENSMUST00000166960] [ENSMUST00000167042] [ENSMUST00000167202] [ENSMUST00000167361] [ENSMUST00000167501] [ENSMUST00000168229] [ENSMUST00000168333] [ENSMUST00000168555] [ENSMUST00000168931] [ENSMUST00000171850] [ENSMUST00000171912] [ENSMUST00000172251] [ENSMUST00000207031] [ENSMUST00000207747] [ENSMUST00000207797] [ENSMUST00000208628]
Predicted Effect probably benign
Transcript: ENSMUST00000006470
SMART Domains Protein: ENSMUSP00000006470
Gene: ENSMUSG00000006307

DomainStartEndE-ValueType
AT_hook 18 30 2.82e2 SMART
low complexity region 66 106 N/A INTRINSIC
low complexity region 110 122 N/A INTRINSIC
AT_hook 149 159 2.4e2 SMART
AT_hook 218 230 1.95e2 SMART
low complexity region 249 263 N/A INTRINSIC
low complexity region 272 302 N/A INTRINSIC
coiled coil region 353 413 N/A INTRINSIC
AT_hook 476 488 5.47e-1 SMART
low complexity region 501 517 N/A INTRINSIC
low complexity region 578 606 N/A INTRINSIC
low complexity region 621 657 N/A INTRINSIC
low complexity region 673 700 N/A INTRINSIC
low complexity region 715 728 N/A INTRINSIC
low complexity region 738 777 N/A INTRINSIC
low complexity region 910 922 N/A INTRINSIC
Pfam:zf-CXXC 963 1010 7.2e-15 PFAM
low complexity region 1039 1061 N/A INTRINSIC
low complexity region 1103 1115 N/A INTRINSIC
PHD 1209 1256 1.25e-5 SMART
PHD 1257 1307 5.4e-10 SMART
PHD 1343 1400 1.27e-6 SMART
low complexity region 1415 1427 N/A INTRINSIC
PHD 1646 1692 3.82e-1 SMART
FYRN 1745 1788 3.25e-19 SMART
low complexity region 1881 1899 N/A INTRINSIC
low complexity region 1912 1942 N/A INTRINSIC
low complexity region 1961 1978 N/A INTRINSIC
low complexity region 1991 2003 N/A INTRINSIC
low complexity region 2013 2026 N/A INTRINSIC
low complexity region 2048 2061 N/A INTRINSIC
low complexity region 2087 2105 N/A INTRINSIC
low complexity region 2127 2138 N/A INTRINSIC
low complexity region 2215 2235 N/A INTRINSIC
low complexity region 2239 2270 N/A INTRINSIC
low complexity region 2396 2406 N/A INTRINSIC
FYRC 2419 2504 4.83e-36 SMART
SET 2581 2703 1.67e-42 SMART
PostSET 2705 2721 4.65e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000043273
AA Change: T87I

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000039406
Gene: ENSMUSG00000078765
AA Change: T87I

DomainStartEndE-ValueType
ZnF_C3H1 13 39 4.79e-3 SMART
RRM 66 143 5.99e-4 SMART
ZnF_C3H1 149 175 2.49e-1 SMART
low complexity region 187 219 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000043850
SMART Domains Protein: ENSMUSP00000042312
Gene: ENSMUSG00000036826

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
transmembrane domain 166 188 N/A INTRINSIC
low complexity region 247 264 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000043898
SMART Domains Protein: ENSMUSP00000044682
Gene: ENSMUSG00000036835

DomainStartEndE-ValueType
Pfam:PEN-2 7 99 2.9e-43 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000043975
SMART Domains Protein: ENSMUSP00000048557
Gene: ENSMUSG00000036845

DomainStartEndE-ValueType
Pfam:LIN37 84 240 5e-51 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108154
SMART Domains Protein: ENSMUSP00000103789
Gene: ENSMUSG00000006307

DomainStartEndE-ValueType
AT_hook 18 30 2.82e2 SMART
low complexity region 66 106 N/A INTRINSIC
low complexity region 110 122 N/A INTRINSIC
AT_hook 149 159 2.4e2 SMART
AT_hook 218 230 1.95e2 SMART
low complexity region 249 263 N/A INTRINSIC
low complexity region 272 302 N/A INTRINSIC
coiled coil region 353 413 N/A INTRINSIC
AT_hook 476 488 5.47e-1 SMART
low complexity region 501 517 N/A INTRINSIC
low complexity region 578 606 N/A INTRINSIC
low complexity region 621 657 N/A INTRINSIC
low complexity region 673 700 N/A INTRINSIC
low complexity region 715 728 N/A INTRINSIC
low complexity region 738 777 N/A INTRINSIC
low complexity region 910 922 N/A INTRINSIC
Pfam:zf-CXXC 963 1010 1e-14 PFAM
low complexity region 1039 1061 N/A INTRINSIC
low complexity region 1103 1115 N/A INTRINSIC
PHD 1209 1256 1.25e-5 SMART
PHD 1257 1307 5.4e-10 SMART
PHD 1343 1400 1.27e-6 SMART
low complexity region 1415 1427 N/A INTRINSIC
PHD 1646 1692 3.82e-1 SMART
FYRN 1745 1788 3.25e-19 SMART
low complexity region 1872 1890 N/A INTRINSIC
low complexity region 1903 1933 N/A INTRINSIC
low complexity region 1952 1969 N/A INTRINSIC
low complexity region 1982 1994 N/A INTRINSIC
low complexity region 2004 2017 N/A INTRINSIC
low complexity region 2039 2052 N/A INTRINSIC
low complexity region 2078 2096 N/A INTRINSIC
low complexity region 2118 2129 N/A INTRINSIC
low complexity region 2206 2226 N/A INTRINSIC
low complexity region 2230 2261 N/A INTRINSIC
low complexity region 2383 2398 N/A INTRINSIC
FYRC 2411 2496 4.83e-36 SMART
SET 2573 2695 1.67e-42 SMART
PostSET 2697 2713 4.65e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108161
AA Change: T87I

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000103796
Gene: ENSMUSG00000109378
AA Change: T87I

DomainStartEndE-ValueType
Pfam:zf-CCCH 13 39 8.8e-10 PFAM
SCOP:d1jmta_ 43 115 2e-17 SMART
PDB:1JMT|A 43 116 3e-40 PDB
Blast:RRM 45 116 2e-36 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000108164
SMART Domains Protein: ENSMUSP00000103799
Gene: ENSMUSG00000036845

DomainStartEndE-ValueType
Pfam:LIN37 58 229 1.4e-45 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000131002
SMART Domains Protein: ENSMUSP00000118486
Gene: ENSMUSG00000006307

DomainStartEndE-ValueType
low complexity region 7 20 N/A INTRINSIC
low complexity region 30 69 N/A INTRINSIC
low complexity region 202 214 N/A INTRINSIC
Pfam:zf-CXXC 255 302 5.2e-15 PFAM
low complexity region 331 353 N/A INTRINSIC
low complexity region 395 407 N/A INTRINSIC
PHD 501 548 1.25e-5 SMART
PHD 549 599 5.4e-10 SMART
PHD 635 692 1.27e-6 SMART
low complexity region 707 719 N/A INTRINSIC
PHD 938 984 3.82e-1 SMART
FYRN 1037 1080 3.25e-19 SMART
low complexity region 1173 1191 N/A INTRINSIC
low complexity region 1204 1234 N/A INTRINSIC
low complexity region 1253 1270 N/A INTRINSIC
low complexity region 1283 1295 N/A INTRINSIC
low complexity region 1305 1318 N/A INTRINSIC
low complexity region 1340 1353 N/A INTRINSIC
low complexity region 1379 1397 N/A INTRINSIC
low complexity region 1419 1430 N/A INTRINSIC
low complexity region 1507 1527 N/A INTRINSIC
low complexity region 1531 1562 N/A INTRINSIC
low complexity region 1684 1699 N/A INTRINSIC
FYRC 1712 1797 4.83e-36 SMART
SET 1874 1996 1.67e-42 SMART
PostSET 1998 2014 4.65e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149400
Predicted Effect probably benign
Transcript: ENSMUST00000156241
SMART Domains Protein: ENSMUSP00000122248
Gene: ENSMUSG00000036845

DomainStartEndE-ValueType
Pfam:LIN37 80 202 7.5e-29 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000163276
Predicted Effect probably benign
Transcript: ENSMUST00000163330
SMART Domains Protein: ENSMUSP00000129385
Gene: ENSMUSG00000078765

DomainStartEndE-ValueType
RRM 39 116 5.99e-4 SMART
Pfam:zf-CCCH 122 148 4.9e-8 PFAM
low complexity region 160 192 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000163464
AA Change: T87I

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000125959
Gene: ENSMUSG00000078765
AA Change: T87I

DomainStartEndE-ValueType
ZnF_C3H1 13 39 4.79e-3 SMART
RRM 66 143 5.99e-4 SMART
ZnF_C3H1 149 171 3.95e1 SMART
low complexity region 183 215 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000163482
SMART Domains Protein: ENSMUSP00000130649
Gene: ENSMUSG00000078765

DomainStartEndE-ValueType
low complexity region 34 54 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000163654
AA Change: T87I

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000131048
Gene: ENSMUSG00000078765
AA Change: T87I

DomainStartEndE-ValueType
Pfam:zf-CCCH 13 39 1.3e-9 PFAM
RRM 66 143 5.99e-4 SMART
low complexity region 167 187 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000163848
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163994
Predicted Effect probably benign
Transcript: ENSMUST00000164365
Predicted Effect noncoding transcript
Transcript: ENSMUST00000164438
Predicted Effect noncoding transcript
Transcript: ENSMUST00000165009
Predicted Effect noncoding transcript
Transcript: ENSMUST00000165524
Predicted Effect noncoding transcript
Transcript: ENSMUST00000165543
Predicted Effect probably benign
Transcript: ENSMUST00000165722
SMART Domains Protein: ENSMUSP00000125790
Gene: ENSMUSG00000078765

DomainStartEndE-ValueType
Pfam:zf-CCCH 1 26 4.7e-10 PFAM
PDB:1JMT|A 30 51 2e-6 PDB
SCOP:d1jmta_ 30 51 5e-3 SMART
Blast:RRM 32 53 7e-8 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000165773
Predicted Effect probably benign
Transcript: ENSMUST00000166257
AA Change: T48I

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000125838
Gene: ENSMUSG00000078765
AA Change: T48I

DomainStartEndE-ValueType
ZnF_C3H1 13 39 4.79e-3 SMART
RRM 33 104 2.35e-2 SMART
ZnF_C3H1 110 136 2.49e-1 SMART
low complexity region 148 180 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000166510
AA Change: T77I

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000132316
Gene: ENSMUSG00000078765
AA Change: T77I

DomainStartEndE-ValueType
ZnF_C3H1 13 39 4.79e-3 SMART
RRM 45 133 2.51e-6 SMART
ZnF_C3H1 139 165 2.49e-1 SMART
low complexity region 177 209 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000166864
Predicted Effect probably benign
Transcript: ENSMUST00000166960
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167024
Predicted Effect probably benign
Transcript: ENSMUST00000167042
AA Change: T87I

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000128886
Gene: ENSMUSG00000109378
AA Change: T87I

DomainStartEndE-ValueType
ZnF_C3H1 13 39 4.79e-3 SMART
RRM 66 143 5.99e-4 SMART
ZnF_C3H1 149 175 2.49e-1 SMART
low complexity region 187 219 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000167202
AA Change: T65I

PolyPhen 2 Score 0.053 (Sensitivity: 0.94; Specificity: 0.84)
Predicted Effect probably benign
Transcript: ENSMUST00000167361
Predicted Effect probably benign
Transcript: ENSMUST00000167501
Predicted Effect noncoding transcript
Transcript: ENSMUST00000168222
Predicted Effect probably benign
Transcript: ENSMUST00000168229
Predicted Effect probably benign
Transcript: ENSMUST00000168333
AA Change: T87I

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000128950
Gene: ENSMUSG00000078765
AA Change: T87I

DomainStartEndE-ValueType
Pfam:zf-CCCH 13 39 4.8e-10 PFAM
PDB:1JMT|A 43 94 5e-21 PDB
SCOP:d1jmta_ 43 94 2e-9 SMART
Blast:RRM 45 94 5e-17 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000168555
Predicted Effect probably benign
Transcript: ENSMUST00000168931
AA Change: T65I

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000129697
Gene: ENSMUSG00000078765
AA Change: T65I

DomainStartEndE-ValueType
RRM 44 119 4.14e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169071
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169283
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169911
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169962
Predicted Effect noncoding transcript
Transcript: ENSMUST00000170453
Predicted Effect noncoding transcript
Transcript: ENSMUST00000171364
Predicted Effect probably benign
Transcript: ENSMUST00000171850
SMART Domains Protein: ENSMUSP00000131781
Gene: ENSMUSG00000078765

DomainStartEndE-ValueType
ZnF_C3H1 13 39 4.79e-3 SMART
PDB:1JMT|A 43 113 1e-16 PDB
SCOP:d1jmta_ 43 113 1e-9 SMART
Blast:RRM 45 110 3e-17 BLAST
ZnF_C3H1 116 142 2.49e-1 SMART
low complexity region 154 186 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000171912
AA Change: T87I

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000130983
Gene: ENSMUSG00000109378
AA Change: T87I

DomainStartEndE-ValueType
ZnF_C3H1 13 39 4.79e-3 SMART
RRM 66 143 5.99e-4 SMART
ZnF_C3H1 149 175 2.49e-1 SMART
low complexity region 187 219 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000172251
SMART Domains Protein: ENSMUSP00000132400
Gene: ENSMUSG00000036826

DomainStartEndE-ValueType
signal peptide 1 41 N/A INTRINSIC
transmembrane domain 186 208 N/A INTRINSIC
low complexity region 267 284 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000207031
Predicted Effect probably benign
Transcript: ENSMUST00000207747
Predicted Effect probably benign
Transcript: ENSMUST00000207797
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207972
Predicted Effect probably benign
Transcript: ENSMUST00000208628
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209110
Meta Mutation Damage Score 0.1834 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.5%
Validation Efficiency 98% (61/62)
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele display abnormal circadian rhythms in response to changing external cues. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ago4 T A 4: 126,496,764 D821V possibly damaging Het
Ankdd1b C A 13: 96,420,773 R384L probably damaging Het
Ces1e A G 8: 93,223,958 F65S probably damaging Het
Cfap53 A C 18: 74,329,459 S425R probably benign Het
Corin A G 5: 72,304,955 V837A probably damaging Het
Cyp2d34 A T 15: 82,618,371 V188E probably damaging Het
Defb26 A T 2: 152,507,958 M134K unknown Het
Dnah10 A C 5: 124,785,156 K2158N probably damaging Het
Dnah9 C T 11: 66,112,333 V882M probably benign Het
Dpyd C A 3: 118,797,422 Y186* probably null Het
Elovl1 G A 4: 118,430,927 probably benign Het
Fars2 T A 13: 36,342,018 I329N probably damaging Het
Gstm1 T A 3: 108,016,363 M109L probably benign Het
Gtf2e1 T C 16: 37,535,931 T80A probably damaging Het
Gtf2h2 A G 13: 100,481,848 probably benign Het
Hrh4 G T 18: 13,015,813 L77F probably damaging Het
Ifi47 A G 11: 49,095,732 T109A probably benign Het
Igsf5 G T 16: 96,391,037 E179* probably null Het
Ints8 A G 4: 11,211,916 I885T probably damaging Het
Iqgap1 T G 7: 80,726,742 I1341L probably benign Het
Kmt2b A G 7: 30,569,794 L2567P probably damaging Het
Lilrb4a T C 10: 51,493,207 probably null Het
Maip1 G A 1: 57,406,972 R67H probably damaging Het
Muc6 T A 7: 141,651,110 I254F possibly damaging Het
Nfkb1 A T 3: 135,612,412 probably null Het
Nlrp4a T C 7: 26,459,811 probably null Het
Nrap A T 19: 56,320,223 I1477N possibly damaging Het
Pdgfa A G 5: 138,993,294 S52P probably benign Het
Pou1f1 G T 16: 65,531,982 E196* probably null Het
Ppp2r5e G A 12: 75,593,271 R19W probably damaging Het
Ptn T A 6: 36,744,484 Q7L probably benign Het
Rbp3 G T 14: 33,954,850 A252S probably damaging Het
Rcor2 G T 19: 7,274,061 V313L probably damaging Het
Rtp3 A T 9: 110,986,127 probably benign Het
Ryr2 T C 13: 11,772,437 T1017A probably damaging Het
Scgb2b11 T C 7: 32,209,351 N108S probably benign Het
Sgo2b C A 8: 63,943,137 L28F probably damaging Het
Shroom3 A G 5: 92,964,573 E1850G probably damaging Het
Slc16a14 A G 1: 84,912,891 L231P probably benign Het
Slfn5 A G 11: 82,956,670 E127G possibly damaging Het
Snx16 C T 3: 10,437,832 M118I probably damaging Het
Snx21 T C 2: 164,791,821 F176L probably damaging Het
Tap2 A G 17: 34,214,016 N424S probably benign Het
Tcf7l1 T C 6: 72,636,466 probably benign Het
Trappc8 C T 18: 20,818,190 V1400I probably benign Het
Trim58 T C 11: 58,651,668 Y485H possibly damaging Het
Ufl1 G T 4: 25,251,294 probably benign Het
Usp8 A G 2: 126,751,111 N762S probably damaging Het
Virma A T 4: 11,539,926 D1465V probably benign Het
Vmn1r48 A T 6: 90,036,034 S270T probably benign Het
Vrk2 T A 11: 26,591,697 Y9F possibly damaging Het
Wwp1 A G 4: 19,631,057 F659L probably damaging Het
Zbtb24 C T 10: 41,464,560 Q529* probably null Het
Zranb1 CTGATGATGATG CTGATGATGATGATG 7: 132,982,827 probably benign Het
Other mutations in U2af1l4
AlleleSourceChrCoordTypePredicted EffectPPH Score
R4738:U2af1l4 UTSW 7 30563348 intron probably benign
R6164:U2af1l4 UTSW 7 30564582 missense probably damaging 0.99
R7164:U2af1l4 UTSW 7 30565119 missense probably benign 0.08
R7429:U2af1l4 UTSW 7 30563390 missense probably benign 0.25
R7569:U2af1l4 UTSW 7 30563557 missense probably damaging 0.99
Z1176:U2af1l4 UTSW 7 30564281 missense probably benign 0.00
Z1177:U2af1l4 UTSW 7 30565140 missense unknown
Predicted Primers PCR Primer
(F):5'- AGACAGCCCCAGCAGTTTAC -3'
(R):5'- ATCTTCAGGGGACTAGTCAGCTC -3'

Sequencing Primer
(F):5'- AGCAGTTTACGCCCTCATTTCAC -3'
(R):5'- AGGCTGGACTCAACTTATCG -3'
Posted On2016-07-06