Incidental Mutation 'R5262:Iqgap1'
ID401502
Institutional Source Beutler Lab
Gene Symbol Iqgap1
Ensembl Gene ENSMUSG00000030536
Gene NameIQ motif containing GTPase activating protein 1
SynonymsD7Ertd237e, D7Ertd257e
MMRRC Submission 042857-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5262 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location80711583-80825974 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 80726742 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Leucine at position 1341 (I1341L)
Ref Sequence ENSEMBL: ENSMUSP00000128278 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000167377]
Predicted Effect probably benign
Transcript: ENSMUST00000167377
AA Change: I1341L

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000128278
Gene: ENSMUSG00000030536
AA Change: I1341L

DomainStartEndE-ValueType
CH 46 155 2.02e-20 SMART
internal_repeat_1 203 278 3.71e-8 PROSPERO
low complexity region 324 335 N/A INTRINSIC
low complexity region 390 399 N/A INTRINSIC
coiled coil region 488 515 N/A INTRINSIC
internal_repeat_1 608 684 3.71e-8 PROSPERO
IQ 744 766 3.85e-3 SMART
IQ 774 796 1.12e-4 SMART
IQ 804 826 1.32e-1 SMART
IQ 834 856 1.15e1 SMART
coiled coil region 886 914 N/A INTRINSIC
RasGAP 992 1345 7.46e-89 SMART
Pfam:RasGAP_C 1452 1580 4.5e-41 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000205606
Meta Mutation Damage Score 0.0818 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.5%
Validation Efficiency 98% (61/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the IQGAP family. The protein contains four IQ domains, one calponin homology domain, one Ras-GAP domain and one WW domain. It interacts with components of the cytoskeleton, with cell adhesion molecules, and with several signaling molecules to regulate cell morphology and motility. Expression of the protein is upregulated by gene amplification in two gastric cancer cell lines. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null allele exhibit a late-onset gastric hyperplasia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ago4 T A 4: 126,496,764 D821V possibly damaging Het
Ankdd1b C A 13: 96,420,773 R384L probably damaging Het
Ces1e A G 8: 93,223,958 F65S probably damaging Het
Cfap53 A C 18: 74,329,459 S425R probably benign Het
Corin A G 5: 72,304,955 V837A probably damaging Het
Cyp2d34 A T 15: 82,618,371 V188E probably damaging Het
Defb26 A T 2: 152,507,958 M134K unknown Het
Dnah10 A C 5: 124,785,156 K2158N probably damaging Het
Dnah9 C T 11: 66,112,333 V882M probably benign Het
Dpyd C A 3: 118,797,422 Y186* probably null Het
Elovl1 G A 4: 118,430,927 probably benign Het
Fars2 T A 13: 36,342,018 I329N probably damaging Het
Gstm1 T A 3: 108,016,363 M109L probably benign Het
Gtf2e1 T C 16: 37,535,931 T80A probably damaging Het
Gtf2h2 A G 13: 100,481,848 probably benign Het
Hrh4 G T 18: 13,015,813 L77F probably damaging Het
Ifi47 A G 11: 49,095,732 T109A probably benign Het
Igsf5 G T 16: 96,391,037 E179* probably null Het
Ints8 A G 4: 11,211,916 I885T probably damaging Het
Kmt2b A G 7: 30,569,794 L2567P probably damaging Het
Lilrb4a T C 10: 51,493,207 probably null Het
Maip1 G A 1: 57,406,972 R67H probably damaging Het
Muc6 T A 7: 141,651,110 I254F possibly damaging Het
Nfkb1 A T 3: 135,612,412 probably null Het
Nlrp4a T C 7: 26,459,811 probably null Het
Nrap A T 19: 56,320,223 I1477N possibly damaging Het
Pdgfa A G 5: 138,993,294 S52P probably benign Het
Pou1f1 G T 16: 65,531,982 E196* probably null Het
Ppp2r5e G A 12: 75,593,271 R19W probably damaging Het
Ptn T A 6: 36,744,484 Q7L probably benign Het
Rbp3 G T 14: 33,954,850 A252S probably damaging Het
Rcor2 G T 19: 7,274,061 V313L probably damaging Het
Rtp3 A T 9: 110,986,127 probably benign Het
Ryr2 T C 13: 11,772,437 T1017A probably damaging Het
Scgb2b11 T C 7: 32,209,351 N108S probably benign Het
Sgo2b C A 8: 63,943,137 L28F probably damaging Het
Shroom3 A G 5: 92,964,573 E1850G probably damaging Het
Slc16a14 A G 1: 84,912,891 L231P probably benign Het
Slfn5 A G 11: 82,956,670 E127G possibly damaging Het
Snx16 C T 3: 10,437,832 M118I probably damaging Het
Snx21 T C 2: 164,791,821 F176L probably damaging Het
Tap2 A G 17: 34,214,016 N424S probably benign Het
Tcf7l1 T C 6: 72,636,466 probably benign Het
Trappc8 C T 18: 20,818,190 V1400I probably benign Het
Trim58 T C 11: 58,651,668 Y485H possibly damaging Het
U2af1l4 C T 7: 30,564,213 T65I probably benign Het
Ufl1 G T 4: 25,251,294 probably benign Het
Usp8 A G 2: 126,751,111 N762S probably damaging Het
Virma A T 4: 11,539,926 D1465V probably benign Het
Vmn1r48 A T 6: 90,036,034 S270T probably benign Het
Vrk2 T A 11: 26,591,697 Y9F possibly damaging Het
Wwp1 A G 4: 19,631,057 F659L probably damaging Het
Zbtb24 C T 10: 41,464,560 Q529* probably null Het
Zranb1 CTGATGATGATG CTGATGATGATGATG 7: 132,982,827 probably benign Het
Other mutations in Iqgap1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00481:Iqgap1 APN 7 80759844 missense probably benign 0.00
IGL00984:Iqgap1 APN 7 80726798 missense probably damaging 1.00
IGL01570:Iqgap1 APN 7 80723061 missense possibly damaging 0.76
IGL01738:Iqgap1 APN 7 80723900 missense possibly damaging 0.80
IGL02141:Iqgap1 APN 7 80738121 missense probably damaging 1.00
IGL02336:Iqgap1 APN 7 80752293 missense probably benign 0.39
IGL02416:Iqgap1 APN 7 80726038 missense probably damaging 1.00
IGL02597:Iqgap1 APN 7 80723885 missense probably damaging 1.00
IGL02662:Iqgap1 APN 7 80743079 missense probably benign
IGL03157:Iqgap1 APN 7 80751888 missense probably benign 0.34
IGL03189:Iqgap1 APN 7 80713842 missense probably benign 0.12
IGL03216:Iqgap1 APN 7 80743088 missense probably benign 0.33
R0024:Iqgap1 UTSW 7 80751939 missense probably benign
R0126:Iqgap1 UTSW 7 80738322 missense probably benign 0.00
R0144:Iqgap1 UTSW 7 80751920 missense probably damaging 1.00
R0325:Iqgap1 UTSW 7 80751930 missense probably benign 0.01
R0376:Iqgap1 UTSW 7 80723879 missense probably benign 0.01
R0650:Iqgap1 UTSW 7 80736395 missense probably damaging 1.00
R0652:Iqgap1 UTSW 7 80736395 missense probably damaging 1.00
R0741:Iqgap1 UTSW 7 80720987 missense probably benign 0.03
R0751:Iqgap1 UTSW 7 80725573 unclassified probably benign
R1067:Iqgap1 UTSW 7 80723828 missense probably benign 0.01
R1389:Iqgap1 UTSW 7 80759756 critical splice donor site probably null
R1473:Iqgap1 UTSW 7 80734011 missense probably benign 0.00
R1613:Iqgap1 UTSW 7 80768457 missense probably damaging 1.00
R1842:Iqgap1 UTSW 7 80760883 missense probably damaging 1.00
R1909:Iqgap1 UTSW 7 80743828 missense probably benign
R2062:Iqgap1 UTSW 7 80723979 nonsense probably null
R2149:Iqgap1 UTSW 7 80762560 missense probably damaging 1.00
R2153:Iqgap1 UTSW 7 80751953 missense probably benign 0.00
R2153:Iqgap1 UTSW 7 80759903 missense possibly damaging 0.55
R3160:Iqgap1 UTSW 7 80752338 missense probably benign
R3162:Iqgap1 UTSW 7 80752338 missense probably benign
R3605:Iqgap1 UTSW 7 80723789 missense probably benign 0.02
R3709:Iqgap1 UTSW 7 80717087 missense possibly damaging 0.87
R3935:Iqgap1 UTSW 7 80743837 missense possibly damaging 0.54
R3979:Iqgap1 UTSW 7 80759934 missense probably damaging 0.98
R4545:Iqgap1 UTSW 7 80762567 critical splice acceptor site probably null
R4787:Iqgap1 UTSW 7 80735513 missense probably damaging 1.00
R4925:Iqgap1 UTSW 7 80765317 missense probably damaging 1.00
R4953:Iqgap1 UTSW 7 80723776 splice site probably null
R5037:Iqgap1 UTSW 7 80734100 missense probably damaging 1.00
R5158:Iqgap1 UTSW 7 80743068 missense probably benign 0.02
R5183:Iqgap1 UTSW 7 80723065 missense probably damaging 1.00
R5271:Iqgap1 UTSW 7 80734148 missense probably damaging 1.00
R5289:Iqgap1 UTSW 7 80738724 missense possibly damaging 0.88
R5359:Iqgap1 UTSW 7 80766959 missense probably benign 0.00
R5423:Iqgap1 UTSW 7 80799862 missense probably damaging 1.00
R5843:Iqgap1 UTSW 7 80726080 missense probably benign 0.03
R5849:Iqgap1 UTSW 7 80803158 missense probably benign
R6164:Iqgap1 UTSW 7 80809106 missense unknown
R6315:Iqgap1 UTSW 7 80799890 missense possibly damaging 0.65
R6335:Iqgap1 UTSW 7 80728024 missense probably damaging 1.00
R6488:Iqgap1 UTSW 7 80730326 missense probably benign 0.00
R6723:Iqgap1 UTSW 7 80723822 missense probably benign 0.01
R6800:Iqgap1 UTSW 7 80728981 missense possibly damaging 0.56
R6815:Iqgap1 UTSW 7 80766884 critical splice donor site probably null
R7240:Iqgap1 UTSW 7 80759839 missense probably benign 0.22
R7386:Iqgap1 UTSW 7 80726042 missense probably damaging 1.00
R7387:Iqgap1 UTSW 7 80720990 missense probably benign 0.03
R7410:Iqgap1 UTSW 7 80723030 nonsense probably null
R7429:Iqgap1 UTSW 7 80751440 missense probably benign 0.00
R7452:Iqgap1 UTSW 7 80760829 missense possibly damaging 0.80
R7615:Iqgap1 UTSW 7 80730100 missense probably damaging 1.00
R7615:Iqgap1 UTSW 7 80751346 missense probably benign
R7726:Iqgap1 UTSW 7 80757456 missense probably benign 0.37
R7783:Iqgap1 UTSW 7 80809059 missense probably benign 0.01
R7785:Iqgap1 UTSW 7 80738169 missense probably damaging 1.00
R7862:Iqgap1 UTSW 7 80743888 missense probably benign 0.04
R8270:Iqgap1 UTSW 7 80730127 missense probably damaging 1.00
RF004:Iqgap1 UTSW 7 80720875 missense probably benign
RF063:Iqgap1 UTSW 7 80723751 frame shift probably null
X0064:Iqgap1 UTSW 7 80720931 nonsense probably null
X0067:Iqgap1 UTSW 7 80766903 missense probably benign
Z1176:Iqgap1 UTSW 7 80768309 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ACGGTAGCTTCATAAATGTGGGG -3'
(R):5'- CCTCTGGATGTGGCAGTTTC -3'

Sequencing Primer
(F):5'- GATCATTTTGCCAGACACGG -3'
(R):5'- GCAGTTTCGTTGTTTGGTGTC -3'
Posted On2016-07-06