Incidental Mutation 'R5262:Ces1e'
ID401508
Institutional Source Beutler Lab
Gene Symbol Ces1e
Ensembl Gene ENSMUSG00000061959
Gene Namecarboxylesterase 1E
SynonymsEs22, Eg, egasyn, Es-22
MMRRC Submission 042857-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5262 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location93201218-93229619 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 93223958 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 65 (F65S)
Ref Sequence ENSEMBL: ENSMUSP00000135636 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034173] [ENSMUST00000176282]
Predicted Effect probably damaging
Transcript: ENSMUST00000034173
AA Change: F66S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000034173
Gene: ENSMUSG00000061959
AA Change: F66S

DomainStartEndE-ValueType
Pfam:COesterase 1 546 1.7e-174 PFAM
Pfam:Abhydrolase_3 137 282 5.2e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175983
Predicted Effect probably damaging
Transcript: ENSMUST00000176282
AA Change: F65S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000135636
Gene: ENSMUSG00000061959
AA Change: F65S

DomainStartEndE-ValueType
Pfam:COesterase 1 545 8.9e-166 PFAM
Pfam:Abhydrolase_3 136 292 2.7e-10 PFAM
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.5%
Validation Efficiency 98% (61/62)
MGI Phenotype PHENOTYPE: Mice homozygous for a spontaneous mutation lack stable microsomal beta-glucuronidase and display altered processing of lysosomal beta-glucuronidase in liver. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ago4 T A 4: 126,496,764 D821V possibly damaging Het
Ankdd1b C A 13: 96,420,773 R384L probably damaging Het
Cfap53 A C 18: 74,329,459 S425R probably benign Het
Corin A G 5: 72,304,955 V837A probably damaging Het
Cyp2d34 A T 15: 82,618,371 V188E probably damaging Het
Defb26 A T 2: 152,507,958 M134K unknown Het
Dnah10 A C 5: 124,785,156 K2158N probably damaging Het
Dnah9 C T 11: 66,112,333 V882M probably benign Het
Dpyd C A 3: 118,797,422 Y186* probably null Het
Elovl1 G A 4: 118,430,927 probably benign Het
Fars2 T A 13: 36,342,018 I329N probably damaging Het
Gstm1 T A 3: 108,016,363 M109L probably benign Het
Gtf2e1 T C 16: 37,535,931 T80A probably damaging Het
Gtf2h2 A G 13: 100,481,848 probably benign Het
Hrh4 G T 18: 13,015,813 L77F probably damaging Het
Ifi47 A G 11: 49,095,732 T109A probably benign Het
Igsf5 G T 16: 96,391,037 E179* probably null Het
Ints8 A G 4: 11,211,916 I885T probably damaging Het
Iqgap1 T G 7: 80,726,742 I1341L probably benign Het
Kmt2b A G 7: 30,569,794 L2567P probably damaging Het
Lilrb4a T C 10: 51,493,207 probably null Het
Maip1 G A 1: 57,406,972 R67H probably damaging Het
Muc6 T A 7: 141,651,110 I254F possibly damaging Het
Nfkb1 A T 3: 135,612,412 probably null Het
Nlrp4a T C 7: 26,459,811 probably null Het
Nrap A T 19: 56,320,223 I1477N possibly damaging Het
Pdgfa A G 5: 138,993,294 S52P probably benign Het
Pou1f1 G T 16: 65,531,982 E196* probably null Het
Ppp2r5e G A 12: 75,593,271 R19W probably damaging Het
Ptn T A 6: 36,744,484 Q7L probably benign Het
Rbp3 G T 14: 33,954,850 A252S probably damaging Het
Rcor2 G T 19: 7,274,061 V313L probably damaging Het
Rtp3 A T 9: 110,986,127 probably benign Het
Ryr2 T C 13: 11,772,437 T1017A probably damaging Het
Scgb2b11 T C 7: 32,209,351 N108S probably benign Het
Sgo2b C A 8: 63,943,137 L28F probably damaging Het
Shroom3 A G 5: 92,964,573 E1850G probably damaging Het
Slc16a14 A G 1: 84,912,891 L231P probably benign Het
Slfn5 A G 11: 82,956,670 E127G possibly damaging Het
Snx16 C T 3: 10,437,832 M118I probably damaging Het
Snx21 T C 2: 164,791,821 F176L probably damaging Het
Tap2 A G 17: 34,214,016 N424S probably benign Het
Tcf7l1 T C 6: 72,636,466 probably benign Het
Trappc8 C T 18: 20,818,190 V1400I probably benign Het
Trim58 T C 11: 58,651,668 Y485H possibly damaging Het
U2af1l4 C T 7: 30,564,213 T65I probably benign Het
Ufl1 G T 4: 25,251,294 probably benign Het
Usp8 A G 2: 126,751,111 N762S probably damaging Het
Virma A T 4: 11,539,926 D1465V probably benign Het
Vmn1r48 A T 6: 90,036,034 S270T probably benign Het
Vrk2 T A 11: 26,591,697 Y9F possibly damaging Het
Wwp1 A G 4: 19,631,057 F659L probably damaging Het
Zbtb24 C T 10: 41,464,560 Q529* probably null Het
Zranb1 CTGATGATGATG CTGATGATGATGATG 7: 132,982,827 probably benign Het
Other mutations in Ces1e
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00900:Ces1e APN 8 93217617 missense probably damaging 0.98
IGL01358:Ces1e APN 8 93214150 missense probably damaging 0.99
IGL01597:Ces1e APN 8 93210373 missense probably benign 0.01
IGL01875:Ces1e APN 8 93223896 missense probably benign 0.03
IGL02244:Ces1e APN 8 93212349 splice site probably null
IGL03260:Ces1e APN 8 93223917 missense probably benign 0.00
IGL03302:Ces1e APN 8 93223893 critical splice donor site probably null
chaingun UTSW 8 93223958 missense probably damaging 1.00
Chomper UTSW 8 93201839 critical splice donor site probably null
PIT4651001:Ces1e UTSW 8 93215083 missense probably benign 0.00
R0158:Ces1e UTSW 8 93219429 missense probably benign 0.09
R0317:Ces1e UTSW 8 93224039 missense probably benign 0.03
R0530:Ces1e UTSW 8 93219521 splice site probably benign
R0626:Ces1e UTSW 8 93224043 missense probably benign 0.01
R3013:Ces1e UTSW 8 93203287 missense probably benign 0.26
R3815:Ces1e UTSW 8 93201839 critical splice donor site probably null
R4810:Ces1e UTSW 8 93208631 missense probably benign 0.00
R4883:Ces1e UTSW 8 93224088 missense probably benign 0.07
R5155:Ces1e UTSW 8 93201406 makesense probably null
R5287:Ces1e UTSW 8 93208612 missense probably benign 0.00
R5403:Ces1e UTSW 8 93208612 missense probably benign 0.00
R5410:Ces1e UTSW 8 93210442 missense possibly damaging 0.94
R5813:Ces1e UTSW 8 93221677 nonsense probably null
R5891:Ces1e UTSW 8 93203266 missense possibly damaging 0.93
R5966:Ces1e UTSW 8 93219373 critical splice donor site probably null
R6199:Ces1e UTSW 8 93217535 missense probably damaging 1.00
R6381:Ces1e UTSW 8 93217578 missense probably damaging 1.00
R6620:Ces1e UTSW 8 93223918 missense probably damaging 1.00
R6753:Ces1e UTSW 8 93215128 missense probably damaging 0.96
R7180:Ces1e UTSW 8 93215144 missense probably damaging 1.00
R7393:Ces1e UTSW 8 93210417 missense probably benign 0.31
R7421:Ces1e UTSW 8 93215075 missense probably benign 0.00
X0014:Ces1e UTSW 8 93203275 missense probably damaging 1.00
Z1088:Ces1e UTSW 8 93210418 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GAAGTCCTCCACGATGCTCTTG -3'
(R):5'- AAATCCTGGTCTGAGTTTGCC -3'

Sequencing Primer
(F):5'- ACGATGCTCTTGATCCCAGATC -3'
(R):5'- CCCTGATGTGCCCTGATGTG -3'
Posted On2016-07-06