Incidental Mutation 'R5262:Vrk2'
ID401512
Institutional Source Beutler Lab
Gene Symbol Vrk2
Ensembl Gene ENSMUSG00000064090
Gene Namevaccinia related kinase 2
Synonyms2810003O05Rik
MMRRC Submission 042857-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.186) question?
Stock #R5262 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location26471322-26593999 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 26591697 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 9 (Y9F)
Ref Sequence ENSEMBL: ENSMUSP00000105130 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078362] [ENSMUST00000089614] [ENSMUST00000109504] [ENSMUST00000156264]
Predicted Effect possibly damaging
Transcript: ENSMUST00000078362
AA Change: Y9F

PolyPhen 2 Score 0.943 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000077471
Gene: ENSMUSG00000064090
AA Change: Y9F

DomainStartEndE-ValueType
Pfam:Pkinase 29 298 4.4e-18 PFAM
Pfam:Pkinase_Tyr 29 313 2e-11 PFAM
low complexity region 365 376 N/A INTRINSIC
transmembrane domain 480 502 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000089614
SMART Domains Protein: ENSMUSP00000087041
Gene: ENSMUSG00000068314

DomainStartEndE-ValueType
low complexity region 19 46 N/A INTRINSIC
low complexity region 73 87 N/A INTRINSIC
low complexity region 104 115 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000109504
AA Change: Y9F

PolyPhen 2 Score 0.943 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000105130
Gene: ENSMUSG00000064090
AA Change: Y9F

DomainStartEndE-ValueType
Pfam:Pkinase 29 302 2.8e-22 PFAM
Pfam:Pkinase_Tyr 29 313 1.3e-11 PFAM
low complexity region 365 376 N/A INTRINSIC
transmembrane domain 480 502 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124294
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125545
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155728
Predicted Effect possibly damaging
Transcript: ENSMUST00000156264
AA Change: Y9F

PolyPhen 2 Score 0.658 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000119928
Gene: ENSMUSG00000064090
AA Change: Y9F

DomainStartEndE-ValueType
PDB:2V62|B 13 111 7e-56 PDB
Meta Mutation Damage Score 0.0596 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.5%
Validation Efficiency 98% (61/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the vaccinia-related kinase (VRK) family of serine/threonine protein kinases. The encoded protein acts as an effector of signaling pathways that regulate apoptosis and tumor cell growth. Variants in this gene have been associated with schizophrenia. Alternative splicing results in multiple transcript variants that differ in their subcellular localization and biological activity. [provided by RefSeq, Jan 2014]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ago4 T A 4: 126,496,764 D821V possibly damaging Het
Ankdd1b C A 13: 96,420,773 R384L probably damaging Het
Ces1e A G 8: 93,223,958 F65S probably damaging Het
Cfap53 A C 18: 74,329,459 S425R probably benign Het
Corin A G 5: 72,304,955 V837A probably damaging Het
Cyp2d34 A T 15: 82,618,371 V188E probably damaging Het
Defb26 A T 2: 152,507,958 M134K unknown Het
Dnah10 A C 5: 124,785,156 K2158N probably damaging Het
Dnah9 C T 11: 66,112,333 V882M probably benign Het
Dpyd C A 3: 118,797,422 Y186* probably null Het
Elovl1 G A 4: 118,430,927 probably benign Het
Fars2 T A 13: 36,342,018 I329N probably damaging Het
Gstm1 T A 3: 108,016,363 M109L probably benign Het
Gtf2e1 T C 16: 37,535,931 T80A probably damaging Het
Gtf2h2 A G 13: 100,481,848 probably benign Het
Hrh4 G T 18: 13,015,813 L77F probably damaging Het
Ifi47 A G 11: 49,095,732 T109A probably benign Het
Igsf5 G T 16: 96,391,037 E179* probably null Het
Ints8 A G 4: 11,211,916 I885T probably damaging Het
Iqgap1 T G 7: 80,726,742 I1341L probably benign Het
Kmt2b A G 7: 30,569,794 L2567P probably damaging Het
Lilrb4a T C 10: 51,493,207 probably null Het
Maip1 G A 1: 57,406,972 R67H probably damaging Het
Muc6 T A 7: 141,651,110 I254F possibly damaging Het
Nfkb1 A T 3: 135,612,412 probably null Het
Nlrp4a T C 7: 26,459,811 probably null Het
Nrap A T 19: 56,320,223 I1477N possibly damaging Het
Pdgfa A G 5: 138,993,294 S52P probably benign Het
Pou1f1 G T 16: 65,531,982 E196* probably null Het
Ppp2r5e G A 12: 75,593,271 R19W probably damaging Het
Ptn T A 6: 36,744,484 Q7L probably benign Het
Rbp3 G T 14: 33,954,850 A252S probably damaging Het
Rcor2 G T 19: 7,274,061 V313L probably damaging Het
Rtp3 A T 9: 110,986,127 probably benign Het
Ryr2 T C 13: 11,772,437 T1017A probably damaging Het
Scgb2b11 T C 7: 32,209,351 N108S probably benign Het
Sgo2b C A 8: 63,943,137 L28F probably damaging Het
Shroom3 A G 5: 92,964,573 E1850G probably damaging Het
Slc16a14 A G 1: 84,912,891 L231P probably benign Het
Slfn5 A G 11: 82,956,670 E127G possibly damaging Het
Snx16 C T 3: 10,437,832 M118I probably damaging Het
Snx21 T C 2: 164,791,821 F176L probably damaging Het
Tap2 A G 17: 34,214,016 N424S probably benign Het
Tcf7l1 T C 6: 72,636,466 probably benign Het
Trappc8 C T 18: 20,818,190 V1400I probably benign Het
Trim58 T C 11: 58,651,668 Y485H possibly damaging Het
U2af1l4 C T 7: 30,564,213 T65I probably benign Het
Ufl1 G T 4: 25,251,294 probably benign Het
Usp8 A G 2: 126,751,111 N762S probably damaging Het
Virma A T 4: 11,539,926 D1465V probably benign Het
Vmn1r48 A T 6: 90,036,034 S270T probably benign Het
Wwp1 A G 4: 19,631,057 F659L probably damaging Het
Zbtb24 C T 10: 41,464,560 Q529* probably null Het
Zranb1 CTGATGATGATG CTGATGATGATGATG 7: 132,982,827 probably benign Het
Other mutations in Vrk2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01865:Vrk2 APN 11 26535560 missense possibly damaging 0.73
IGL02011:Vrk2 APN 11 26471717 missense probably benign 0.10
IGL02185:Vrk2 APN 11 26535638 nonsense probably null
IGL02257:Vrk2 APN 11 26534266 missense probably damaging 1.00
IGL02424:Vrk2 APN 11 26476564 missense probably benign 0.00
macromacro UTSW 11 26549325 missense probably damaging 1.00
R0127:Vrk2 UTSW 11 26534313 splice site probably benign
R0184:Vrk2 UTSW 11 26550046 missense probably damaging 0.98
R0670:Vrk2 UTSW 11 26486959 critical splice donor site probably null
R0751:Vrk2 UTSW 11 26483331 splice site probably benign
R0766:Vrk2 UTSW 11 26535522 splice site probably benign
R1103:Vrk2 UTSW 11 26549325 missense probably damaging 1.00
R1184:Vrk2 UTSW 11 26483331 splice site probably benign
R1312:Vrk2 UTSW 11 26535522 splice site probably benign
R2041:Vrk2 UTSW 11 26547914 missense probably benign 0.01
R2857:Vrk2 UTSW 11 26483324 missense possibly damaging 0.54
R2859:Vrk2 UTSW 11 26483324 missense possibly damaging 0.54
R3615:Vrk2 UTSW 11 26489866 missense possibly damaging 0.90
R3616:Vrk2 UTSW 11 26489866 missense possibly damaging 0.90
R4163:Vrk2 UTSW 11 26547915 missense probably benign 0.00
R4651:Vrk2 UTSW 11 26489803 missense probably damaging 0.98
R4652:Vrk2 UTSW 11 26489803 missense probably damaging 0.98
R4662:Vrk2 UTSW 11 26471611 missense possibly damaging 0.95
R5458:Vrk2 UTSW 11 26498919 missense probably damaging 0.99
R5529:Vrk2 UTSW 11 26499036 missense probably damaging 1.00
R5840:Vrk2 UTSW 11 26534314 splice site probably benign
R5892:Vrk2 UTSW 11 26534372 intron probably benign
R6054:Vrk2 UTSW 11 26486975 missense probably benign 0.20
R6923:Vrk2 UTSW 11 26489893 missense probably damaging 1.00
R6952:Vrk2 UTSW 11 26535597 missense probably damaging 0.97
R7841:Vrk2 UTSW 11 26471457 missense probably damaging 1.00
R8165:Vrk2 UTSW 11 26535575 missense probably benign 0.21
Predicted Primers PCR Primer
(F):5'- GACAAACAGGGAACATGTTATGTC -3'
(R):5'- CACATGTCAGTATCTCTTAGGTTTC -3'

Sequencing Primer
(F):5'- CAGGGAACATGTTATGTCAGTTATG -3'
(R):5'- GATGGCTTATCCAGTTGG -3'
Posted On2016-07-06