Incidental Mutation 'R5262:Trim58'
ID401514
Institutional Source Beutler Lab
Gene Symbol Trim58
Ensembl Gene ENSMUSG00000037124
Gene Nametripartite motif-containing 58
SynonymsLOC386443, LOC216781
MMRRC Submission 042857-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.052) question?
Stock #R5262 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location58640465-58652404 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 58651668 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 485 (Y485H)
Ref Sequence ENSEMBL: ENSMUSP00000074594 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075084]
Predicted Effect possibly damaging
Transcript: ENSMUST00000075084
AA Change: Y485H

PolyPhen 2 Score 0.876 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000074594
Gene: ENSMUSG00000037124
AA Change: Y485H

DomainStartEndE-ValueType
RING 15 58 2.95e-7 SMART
BBOX 90 131 2.93e-11 SMART
coiled coil region 192 241 N/A INTRINSIC
PRY 289 341 5.33e-23 SMART
SPRY 342 461 6.16e-29 SMART
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.5%
Validation Efficiency 98% (61/62)
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ago4 T A 4: 126,496,764 D821V possibly damaging Het
Ankdd1b C A 13: 96,420,773 R384L probably damaging Het
Ces1e A G 8: 93,223,958 F65S probably damaging Het
Cfap53 A C 18: 74,329,459 S425R probably benign Het
Corin A G 5: 72,304,955 V837A probably damaging Het
Cyp2d34 A T 15: 82,618,371 V188E probably damaging Het
Defb26 A T 2: 152,507,958 M134K unknown Het
Dnah10 A C 5: 124,785,156 K2158N probably damaging Het
Dnah9 C T 11: 66,112,333 V882M probably benign Het
Dpyd C A 3: 118,797,422 Y186* probably null Het
Elovl1 G A 4: 118,430,927 probably benign Het
Fars2 T A 13: 36,342,018 I329N probably damaging Het
Gstm1 T A 3: 108,016,363 M109L probably benign Het
Gtf2e1 T C 16: 37,535,931 T80A probably damaging Het
Gtf2h2 A G 13: 100,481,848 probably benign Het
Hrh4 G T 18: 13,015,813 L77F probably damaging Het
Ifi47 A G 11: 49,095,732 T109A probably benign Het
Igsf5 G T 16: 96,391,037 E179* probably null Het
Ints8 A G 4: 11,211,916 I885T probably damaging Het
Iqgap1 T G 7: 80,726,742 I1341L probably benign Het
Kmt2b A G 7: 30,569,794 L2567P probably damaging Het
Lilrb4a T C 10: 51,493,207 probably null Het
Maip1 G A 1: 57,406,972 R67H probably damaging Het
Muc6 T A 7: 141,651,110 I254F possibly damaging Het
Nfkb1 A T 3: 135,612,412 probably null Het
Nlrp4a T C 7: 26,459,811 probably null Het
Nrap A T 19: 56,320,223 I1477N possibly damaging Het
Pdgfa A G 5: 138,993,294 S52P probably benign Het
Pou1f1 G T 16: 65,531,982 E196* probably null Het
Ppp2r5e G A 12: 75,593,271 R19W probably damaging Het
Ptn T A 6: 36,744,484 Q7L probably benign Het
Rbp3 G T 14: 33,954,850 A252S probably damaging Het
Rcor2 G T 19: 7,274,061 V313L probably damaging Het
Rtp3 A T 9: 110,986,127 probably benign Het
Ryr2 T C 13: 11,772,437 T1017A probably damaging Het
Scgb2b11 T C 7: 32,209,351 N108S probably benign Het
Sgo2b C A 8: 63,943,137 L28F probably damaging Het
Shroom3 A G 5: 92,964,573 E1850G probably damaging Het
Slc16a14 A G 1: 84,912,891 L231P probably benign Het
Slfn5 A G 11: 82,956,670 E127G possibly damaging Het
Snx16 C T 3: 10,437,832 M118I probably damaging Het
Snx21 T C 2: 164,791,821 F176L probably damaging Het
Tap2 A G 17: 34,214,016 N424S probably benign Het
Tcf7l1 T C 6: 72,636,466 probably benign Het
Trappc8 C T 18: 20,818,190 V1400I probably benign Het
U2af1l4 C T 7: 30,564,213 T65I probably benign Het
Ufl1 G T 4: 25,251,294 probably benign Het
Usp8 A G 2: 126,751,111 N762S probably damaging Het
Virma A T 4: 11,539,926 D1465V probably benign Het
Vmn1r48 A T 6: 90,036,034 S270T probably benign Het
Vrk2 T A 11: 26,591,697 Y9F possibly damaging Het
Wwp1 A G 4: 19,631,057 F659L probably damaging Het
Zbtb24 C T 10: 41,464,560 Q529* probably null Het
Zranb1 CTGATGATGATG CTGATGATGATGATG 7: 132,982,827 probably benign Het
Other mutations in Trim58
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02351:Trim58 APN 11 58651350 missense probably damaging 1.00
IGL02358:Trim58 APN 11 58651350 missense probably damaging 1.00
IGL02792:Trim58 APN 11 58640466 utr 5 prime probably benign
IGL02794:Trim58 APN 11 58640466 utr 5 prime probably benign
IGL02875:Trim58 APN 11 58640466 utr 5 prime probably benign
IGL02934:Trim58 APN 11 58640466 utr 5 prime probably benign
IGL03083:Trim58 APN 11 58651390 missense probably benign 0.01
IGL03213:Trim58 APN 11 58651167 missense probably benign 0.00
R0011:Trim58 UTSW 11 58643120 missense probably benign 0.02
R0011:Trim58 UTSW 11 58643120 missense probably benign 0.02
R0735:Trim58 UTSW 11 58651393 missense probably benign 0.16
R1294:Trim58 UTSW 11 58643127 missense probably benign 0.28
R1929:Trim58 UTSW 11 58640667 missense possibly damaging 0.84
R2104:Trim58 UTSW 11 58643138 splice site probably benign
R2311:Trim58 UTSW 11 58643108 missense probably benign 0.02
R2981:Trim58 UTSW 11 58651561 missense probably damaging 1.00
R3432:Trim58 UTSW 11 58646961 splice site probably benign
R4270:Trim58 UTSW 11 58651267 missense probably damaging 1.00
R4450:Trim58 UTSW 11 58651365 missense probably benign 0.03
R4841:Trim58 UTSW 11 58651324 missense probably damaging 0.96
R4842:Trim58 UTSW 11 58651324 missense probably damaging 0.96
R5979:Trim58 UTSW 11 58646083 missense probably damaging 1.00
R6101:Trim58 UTSW 11 58651615 missense probably benign 0.01
R6684:Trim58 UTSW 11 58651620 missense probably benign 0.00
R6747:Trim58 UTSW 11 58651264 missense probably benign 0.02
R7126:Trim58 UTSW 11 58640579 missense probably damaging 1.00
R7981:Trim58 UTSW 11 58651312 missense probably benign 0.26
R8307:Trim58 UTSW 11 58647083 missense probably benign 0.00
X0026:Trim58 UTSW 11 58645969 missense probably damaging 1.00
X0067:Trim58 UTSW 11 58647105 missense possibly damaging 0.89
Z1186:Trim58 UTSW 11 58640858 missense possibly damaging 0.83
Z1186:Trim58 UTSW 11 58651660 missense probably benign
Z1187:Trim58 UTSW 11 58640858 missense possibly damaging 0.83
Z1187:Trim58 UTSW 11 58651660 missense probably benign
Z1188:Trim58 UTSW 11 58640858 missense possibly damaging 0.83
Z1188:Trim58 UTSW 11 58651660 missense probably benign
Z1189:Trim58 UTSW 11 58640858 missense possibly damaging 0.83
Z1189:Trim58 UTSW 11 58651660 missense probably benign
Z1190:Trim58 UTSW 11 58640858 missense possibly damaging 0.83
Z1190:Trim58 UTSW 11 58651660 missense probably benign
Z1191:Trim58 UTSW 11 58640858 missense possibly damaging 0.83
Z1191:Trim58 UTSW 11 58651660 missense probably benign
Z1192:Trim58 UTSW 11 58640858 missense possibly damaging 0.83
Z1192:Trim58 UTSW 11 58651660 missense probably benign
Predicted Primers PCR Primer
(F):5'- CCTTCTACAATGTCACAAATGGG -3'
(R):5'- TGTTTGATGAGCCTGCTGCC -3'

Sequencing Primer
(F):5'- GTCACAAATGGGTCTTACATCTACAC -3'
(R):5'- GATGAGCCTGCTGCCTTTCC -3'
Posted On2016-07-06