Incidental Mutation 'R5262:Gtf2h2'
ID401523
Institutional Source Beutler Lab
Gene Symbol Gtf2h2
Ensembl Gene ENSMUSG00000021639
Gene Namegeneral transcription factor II H, polypeptide 2
Synonymsbasal transcription factor 2, p44 subunit, 44kDa, p44, Btf2p44
MMRRC Submission 042857-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5262 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location100460218-100492579 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) A to G at 100481848 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000066940] [ENSMUST00000066984] [ENSMUST00000134842] [ENSMUST00000145266]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000066940
SMART Domains Protein: ENSMUSP00000064590
Gene: ENSMUSG00000021639

DomainStartEndE-ValueType
Pfam:VWA_2 60 166 5e-9 PFAM
Pfam:Ssl1 64 166 1.1e-44 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000066984
SMART Domains Protein: ENSMUSP00000065228
Gene: ENSMUSG00000021639

DomainStartEndE-ValueType
VWA 58 240 1.02e-14 SMART
Blast:BIR 291 310 6e-7 BLAST
C1_4 345 388 3.13e-21 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124644
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124698
Predicted Effect probably benign
Transcript: ENSMUST00000134842
SMART Domains Protein: ENSMUSP00000138748
Gene: ENSMUSG00000021639

DomainStartEndE-ValueType
Pfam:Ssl1 64 139 2.4e-27 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142182
Predicted Effect probably benign
Transcript: ENSMUST00000145266
SMART Domains Protein: ENSMUSP00000138108
Gene: ENSMUSG00000021639

DomainStartEndE-ValueType
VWA 58 240 1.02e-14 SMART
Blast:BIR 291 310 6e-7 BLAST
C1_4 345 388 3.13e-21 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000232450
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.5%
Validation Efficiency 98% (61/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is part of a 500 kb inverted duplication on chromosome 5q13. This duplicated region contains at least four genes and repetitive elements which make it prone to rearrangements and deletions. The repetitiveness and complexity of the sequence have also caused difficulty in determining the organization of this genomic region. This gene is within the telomeric copy of the duplication. Deletion of this gene sometimes accompanies deletion of the neighboring SMN1 gene in spinal muscular atrophy (SMA) patients but it is unclear if deletion of this gene contributes to the SMA phenotype. This gene encodes the 44 kDa subunit of RNA polymerase II transcription initiation factor IIH which is involved in basal transcription and nucleotide excision repair. Transcript variants for this gene have been described, but their full length nature has not been determined. A second copy of this gene within the centromeric copy of the duplication has been described in the literature. It is reported to be different by either two or four base pairs; however, no sequence data is currently available for the centromeric copy of the gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ago4 T A 4: 126,496,764 D821V possibly damaging Het
Ankdd1b C A 13: 96,420,773 R384L probably damaging Het
Ces1e A G 8: 93,223,958 F65S probably damaging Het
Cfap53 A C 18: 74,329,459 S425R probably benign Het
Corin A G 5: 72,304,955 V837A probably damaging Het
Cyp2d34 A T 15: 82,618,371 V188E probably damaging Het
Defb26 A T 2: 152,507,958 M134K unknown Het
Dnah10 A C 5: 124,785,156 K2158N probably damaging Het
Dnah9 C T 11: 66,112,333 V882M probably benign Het
Dpyd C A 3: 118,797,422 Y186* probably null Het
Elovl1 G A 4: 118,430,927 probably benign Het
Fars2 T A 13: 36,342,018 I329N probably damaging Het
Gstm1 T A 3: 108,016,363 M109L probably benign Het
Gtf2e1 T C 16: 37,535,931 T80A probably damaging Het
Hrh4 G T 18: 13,015,813 L77F probably damaging Het
Ifi47 A G 11: 49,095,732 T109A probably benign Het
Igsf5 G T 16: 96,391,037 E179* probably null Het
Ints8 A G 4: 11,211,916 I885T probably damaging Het
Iqgap1 T G 7: 80,726,742 I1341L probably benign Het
Kmt2b A G 7: 30,569,794 L2567P probably damaging Het
Lilrb4a T C 10: 51,493,207 probably null Het
Maip1 G A 1: 57,406,972 R67H probably damaging Het
Muc6 T A 7: 141,651,110 I254F possibly damaging Het
Nfkb1 A T 3: 135,612,412 probably null Het
Nlrp4a T C 7: 26,459,811 probably null Het
Nrap A T 19: 56,320,223 I1477N possibly damaging Het
Pdgfa A G 5: 138,993,294 S52P probably benign Het
Pou1f1 G T 16: 65,531,982 E196* probably null Het
Ppp2r5e G A 12: 75,593,271 R19W probably damaging Het
Ptn T A 6: 36,744,484 Q7L probably benign Het
Rbp3 G T 14: 33,954,850 A252S probably damaging Het
Rcor2 G T 19: 7,274,061 V313L probably damaging Het
Rtp3 A T 9: 110,986,127 probably benign Het
Ryr2 T C 13: 11,772,437 T1017A probably damaging Het
Scgb2b11 T C 7: 32,209,351 N108S probably benign Het
Sgo2b C A 8: 63,943,137 L28F probably damaging Het
Shroom3 A G 5: 92,964,573 E1850G probably damaging Het
Slc16a14 A G 1: 84,912,891 L231P probably benign Het
Slfn5 A G 11: 82,956,670 E127G possibly damaging Het
Snx16 C T 3: 10,437,832 M118I probably damaging Het
Snx21 T C 2: 164,791,821 F176L probably damaging Het
Tap2 A G 17: 34,214,016 N424S probably benign Het
Tcf7l1 T C 6: 72,636,466 probably benign Het
Trappc8 C T 18: 20,818,190 V1400I probably benign Het
Trim58 T C 11: 58,651,668 Y485H possibly damaging Het
U2af1l4 C T 7: 30,564,213 T65I probably benign Het
Ufl1 G T 4: 25,251,294 probably benign Het
Usp8 A G 2: 126,751,111 N762S probably damaging Het
Virma A T 4: 11,539,926 D1465V probably benign Het
Vmn1r48 A T 6: 90,036,034 S270T probably benign Het
Vrk2 T A 11: 26,591,697 Y9F possibly damaging Het
Wwp1 A G 4: 19,631,057 F659L probably damaging Het
Zbtb24 C T 10: 41,464,560 Q529* probably null Het
Zranb1 CTGATGATGATG CTGATGATGATGATG 7: 132,982,827 probably benign Het
Other mutations in Gtf2h2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00585:Gtf2h2 APN 13 100480998 unclassified probably benign
IGL00780:Gtf2h2 APN 13 100479221 missense probably benign 0.01
IGL01475:Gtf2h2 APN 13 100481033 missense probably damaging 1.00
IGL02298:Gtf2h2 APN 13 100481039 missense probably damaging 1.00
IGL02754:Gtf2h2 APN 13 100481239 missense probably damaging 1.00
R0602:Gtf2h2 UTSW 13 100469025 missense probably benign 0.03
R0621:Gtf2h2 UTSW 13 100488925 missense probably damaging 1.00
R0665:Gtf2h2 UTSW 13 100481054 missense probably damaging 1.00
R4709:Gtf2h2 UTSW 13 100469015 nonsense probably null
R4810:Gtf2h2 UTSW 13 100481002 critical splice donor site probably null
R5548:Gtf2h2 UTSW 13 100481036 missense possibly damaging 0.92
R5741:Gtf2h2 UTSW 13 100480558 missense probably benign 0.00
R6802:Gtf2h2 UTSW 13 100480543 missense probably benign 0.39
R7256:Gtf2h2 UTSW 13 100479201 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- TGGAGAGTAAACATGGTTTATTCAG -3'
(R):5'- CATGGGTCTCTATGAAGCCTG -3'

Sequencing Primer
(F):5'- CAATCTCTCTCAAAAAGGTGGGTG -3'
(R):5'- GGGTCTCTATGAAGCCTGTTATAAC -3'
Posted On2016-07-06