Incidental Mutation 'R5262:Gtf2e1'
ID401527
Institutional Source Beutler Lab
Gene Symbol Gtf2e1
Ensembl Gene ENSMUSG00000022828
Gene Namegeneral transcription factor II E, polypeptide 1 (alpha subunit)
SynonymsTFIIE-A, FE, 2610024P03Rik, 56kDa
MMRRC Submission 042857-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.948) question?
Stock #R5262 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location37509790-37539789 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 37535931 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 80 (T80A)
Ref Sequence ENSEMBL: ENSMUSP00000023525 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023524] [ENSMUST00000023525] [ENSMUST00000130028]
Predicted Effect probably benign
Transcript: ENSMUST00000023524
SMART Domains Protein: ENSMUSP00000023524
Gene: ENSMUSG00000022827

DomainStartEndE-ValueType
Pfam:MMR_HSR1 8 128 8.5e-8 PFAM
Pfam:Roc 8 132 1.2e-16 PFAM
Pfam:Ras 8 178 7.9e-15 PFAM
Pfam:Gtr1_RagA 8 181 2.1e-7 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000023525
AA Change: T80A

PolyPhen 2 Score 0.963 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000023525
Gene: ENSMUSG00000022828
AA Change: T80A

DomainStartEndE-ValueType
TFIIE 28 175 2.69e-74 SMART
low complexity region 221 233 N/A INTRINSIC
low complexity region 332 351 N/A INTRINSIC
Pfam:TFIIE-A_C 354 440 9.9e-36 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128036
Predicted Effect probably benign
Transcript: ENSMUST00000130028
SMART Domains Protein: ENSMUSP00000122441
Gene: ENSMUSG00000022827

DomainStartEndE-ValueType
Pfam:Arf 1 126 3.3e-6 PFAM
Pfam:Gtr1_RagA 8 118 5.5e-8 PFAM
Pfam:MMR_HSR1 8 127 9.8e-8 PFAM
Pfam:Ras 8 128 9.5e-15 PFAM
Pfam:Miro 8 129 2.3e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130350
Meta Mutation Damage Score 0.2165 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.5%
Validation Efficiency 98% (61/62)
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ago4 T A 4: 126,496,764 D821V possibly damaging Het
Ankdd1b C A 13: 96,420,773 R384L probably damaging Het
Ces1e A G 8: 93,223,958 F65S probably damaging Het
Cfap53 A C 18: 74,329,459 S425R probably benign Het
Corin A G 5: 72,304,955 V837A probably damaging Het
Cyp2d34 A T 15: 82,618,371 V188E probably damaging Het
Defb26 A T 2: 152,507,958 M134K unknown Het
Dnah10 A C 5: 124,785,156 K2158N probably damaging Het
Dnah9 C T 11: 66,112,333 V882M probably benign Het
Dpyd C A 3: 118,797,422 Y186* probably null Het
Elovl1 G A 4: 118,430,927 probably benign Het
Fars2 T A 13: 36,342,018 I329N probably damaging Het
Gstm1 T A 3: 108,016,363 M109L probably benign Het
Gtf2h2 A G 13: 100,481,848 probably benign Het
Hrh4 G T 18: 13,015,813 L77F probably damaging Het
Ifi47 A G 11: 49,095,732 T109A probably benign Het
Igsf5 G T 16: 96,391,037 E179* probably null Het
Ints8 A G 4: 11,211,916 I885T probably damaging Het
Iqgap1 T G 7: 80,726,742 I1341L probably benign Het
Kmt2b A G 7: 30,569,794 L2567P probably damaging Het
Lilrb4a T C 10: 51,493,207 probably null Het
Maip1 G A 1: 57,406,972 R67H probably damaging Het
Muc6 T A 7: 141,651,110 I254F possibly damaging Het
Nfkb1 A T 3: 135,612,412 probably null Het
Nlrp4a T C 7: 26,459,811 probably null Het
Nrap A T 19: 56,320,223 I1477N possibly damaging Het
Pdgfa A G 5: 138,993,294 S52P probably benign Het
Pou1f1 G T 16: 65,531,982 E196* probably null Het
Ppp2r5e G A 12: 75,593,271 R19W probably damaging Het
Ptn T A 6: 36,744,484 Q7L probably benign Het
Rbp3 G T 14: 33,954,850 A252S probably damaging Het
Rcor2 G T 19: 7,274,061 V313L probably damaging Het
Rtp3 A T 9: 110,986,127 probably benign Het
Ryr2 T C 13: 11,772,437 T1017A probably damaging Het
Scgb2b11 T C 7: 32,209,351 N108S probably benign Het
Sgo2b C A 8: 63,943,137 L28F probably damaging Het
Shroom3 A G 5: 92,964,573 E1850G probably damaging Het
Slc16a14 A G 1: 84,912,891 L231P probably benign Het
Slfn5 A G 11: 82,956,670 E127G possibly damaging Het
Snx16 C T 3: 10,437,832 M118I probably damaging Het
Snx21 T C 2: 164,791,821 F176L probably damaging Het
Tap2 A G 17: 34,214,016 N424S probably benign Het
Tcf7l1 T C 6: 72,636,466 probably benign Het
Trappc8 C T 18: 20,818,190 V1400I probably benign Het
Trim58 T C 11: 58,651,668 Y485H possibly damaging Het
U2af1l4 C T 7: 30,564,213 T65I probably benign Het
Ufl1 G T 4: 25,251,294 probably benign Het
Usp8 A G 2: 126,751,111 N762S probably damaging Het
Virma A T 4: 11,539,926 D1465V probably benign Het
Vmn1r48 A T 6: 90,036,034 S270T probably benign Het
Vrk2 T A 11: 26,591,697 Y9F possibly damaging Het
Wwp1 A G 4: 19,631,057 F659L probably damaging Het
Zbtb24 C T 10: 41,464,560 Q529* probably null Het
Zranb1 CTGATGATGATG CTGATGATGATGATG 7: 132,982,827 probably benign Het
Other mutations in Gtf2e1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00955:Gtf2e1 APN 16 37535920 missense possibly damaging 0.90
IGL00966:Gtf2e1 APN 16 37515730 missense probably benign
IGL03372:Gtf2e1 APN 16 37535715 unclassified probably benign
R2202:Gtf2e1 UTSW 16 37511542 missense possibly damaging 0.49
R2203:Gtf2e1 UTSW 16 37511542 missense possibly damaging 0.49
R6457:Gtf2e1 UTSW 16 37536336 intron probably null
R6522:Gtf2e1 UTSW 16 37511454 missense possibly damaging 0.47
R7165:Gtf2e1 UTSW 16 37535866 missense probably damaging 1.00
R7297:Gtf2e1 UTSW 16 37536065 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCTGTCATGGGATCAAACAGTTG -3'
(R):5'- AGCCAAGTATGTCATCCGGG -3'

Sequencing Primer
(F):5'- CAAACAGTTGATTGGCTTCTAGGTC -3'
(R):5'- CAAGTATGTCATCCGGGGCTTTTATG -3'
Posted On2016-07-06