Incidental Mutation 'R5262:Pou1f1'
ID401528
Institutional Source Beutler Lab
Gene Symbol Pou1f1
Ensembl Gene ENSMUSG00000004842
Gene NamePOU domain, class 1, transcription factor 1
SynonymsPit1, Pit1-rs1, Hmp1, GHF-1, Pit-1
MMRRC Submission 042857-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.936) question?
Stock #R5262 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location65520511-65535005 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to T at 65531982 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Stop codon at position 196 (E196*)
Ref Sequence ENSEMBL: ENSMUSP00000139087 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004964] [ENSMUST00000176038] [ENSMUST00000176330] [ENSMUST00000184525]
Predicted Effect probably null
Transcript: ENSMUST00000004964
AA Change: E224*
SMART Domains Protein: ENSMUSP00000004964
Gene: ENSMUSG00000004842
AA Change: E224*

DomainStartEndE-ValueType
POU 150 224 3.77e-51 SMART
HOX 240 302 2.07e-19 SMART
Predicted Effect probably null
Transcript: ENSMUST00000176038
AA Change: E224*
SMART Domains Protein: ENSMUSP00000135574
Gene: ENSMUSG00000004842
AA Change: E224*

DomainStartEndE-ValueType
POU 150 224 3.77e-51 SMART
HOX 240 302 2.07e-19 SMART
Predicted Effect probably null
Transcript: ENSMUST00000176330
AA Change: E198*
SMART Domains Protein: ENSMUSP00000135113
Gene: ENSMUSG00000004842
AA Change: E198*

DomainStartEndE-ValueType
POU 124 198 3.77e-51 SMART
HOX 214 276 2.07e-19 SMART
Predicted Effect probably null
Transcript: ENSMUST00000184525
AA Change: E196*
SMART Domains Protein: ENSMUSP00000139087
Gene: ENSMUSG00000004842
AA Change: E196*

DomainStartEndE-ValueType
POU 122 196 3.77e-51 SMART
HOX 212 274 2.07e-19 SMART
Meta Mutation Damage Score 0.9717 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.5%
Validation Efficiency 98% (61/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the POU family of transcription factors that regulate mammalian development. The protein regulates expression of several genes involved in pituitary development and hormone expression. Mutations in this genes result in combined pituitary hormone deficiency. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for spontaneous mutations exhibit hypoplasia of the anterior pituitary cells resulting in deficiencies in growth hormone, prolactin, and thyroid-stimulating hormone, dwarfism, and sterility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ago4 T A 4: 126,496,764 D821V possibly damaging Het
Ankdd1b C A 13: 96,420,773 R384L probably damaging Het
Ces1e A G 8: 93,223,958 F65S probably damaging Het
Cfap53 A C 18: 74,329,459 S425R probably benign Het
Corin A G 5: 72,304,955 V837A probably damaging Het
Cyp2d34 A T 15: 82,618,371 V188E probably damaging Het
Defb26 A T 2: 152,507,958 M134K unknown Het
Dnah10 A C 5: 124,785,156 K2158N probably damaging Het
Dnah9 C T 11: 66,112,333 V882M probably benign Het
Dpyd C A 3: 118,797,422 Y186* probably null Het
Elovl1 G A 4: 118,430,927 probably benign Het
Fars2 T A 13: 36,342,018 I329N probably damaging Het
Gstm1 T A 3: 108,016,363 M109L probably benign Het
Gtf2e1 T C 16: 37,535,931 T80A probably damaging Het
Gtf2h2 A G 13: 100,481,848 probably benign Het
Hrh4 G T 18: 13,015,813 L77F probably damaging Het
Ifi47 A G 11: 49,095,732 T109A probably benign Het
Igsf5 G T 16: 96,391,037 E179* probably null Het
Ints8 A G 4: 11,211,916 I885T probably damaging Het
Iqgap1 T G 7: 80,726,742 I1341L probably benign Het
Kmt2b A G 7: 30,569,794 L2567P probably damaging Het
Lilrb4a T C 10: 51,493,207 probably null Het
Maip1 G A 1: 57,406,972 R67H probably damaging Het
Muc6 T A 7: 141,651,110 I254F possibly damaging Het
Nfkb1 A T 3: 135,612,412 probably null Het
Nlrp4a T C 7: 26,459,811 probably null Het
Nrap A T 19: 56,320,223 I1477N possibly damaging Het
Pdgfa A G 5: 138,993,294 S52P probably benign Het
Ppp2r5e G A 12: 75,593,271 R19W probably damaging Het
Ptn T A 6: 36,744,484 Q7L probably benign Het
Rbp3 G T 14: 33,954,850 A252S probably damaging Het
Rcor2 G T 19: 7,274,061 V313L probably damaging Het
Rtp3 A T 9: 110,986,127 probably benign Het
Ryr2 T C 13: 11,772,437 T1017A probably damaging Het
Scgb2b11 T C 7: 32,209,351 N108S probably benign Het
Sgo2b C A 8: 63,943,137 L28F probably damaging Het
Shroom3 A G 5: 92,964,573 E1850G probably damaging Het
Slc16a14 A G 1: 84,912,891 L231P probably benign Het
Slfn5 A G 11: 82,956,670 E127G possibly damaging Het
Snx16 C T 3: 10,437,832 M118I probably damaging Het
Snx21 T C 2: 164,791,821 F176L probably damaging Het
Tap2 A G 17: 34,214,016 N424S probably benign Het
Tcf7l1 T C 6: 72,636,466 probably benign Het
Trappc8 C T 18: 20,818,190 V1400I probably benign Het
Trim58 T C 11: 58,651,668 Y485H possibly damaging Het
U2af1l4 C T 7: 30,564,213 T65I probably benign Het
Ufl1 G T 4: 25,251,294 probably benign Het
Usp8 A G 2: 126,751,111 N762S probably damaging Het
Virma A T 4: 11,539,926 D1465V probably benign Het
Vmn1r48 A T 6: 90,036,034 S270T probably benign Het
Vrk2 T A 11: 26,591,697 Y9F possibly damaging Het
Wwp1 A G 4: 19,631,057 F659L probably damaging Het
Zbtb24 C T 10: 41,464,560 Q529* probably null Het
Zranb1 CTGATGATGATG CTGATGATGATGATG 7: 132,982,827 probably benign Het
Other mutations in Pou1f1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02086:Pou1f1 APN 16 65529898 missense probably damaging 1.00
IGL02416:Pou1f1 APN 16 65531956 missense probably damaging 1.00
IGL02704:Pou1f1 APN 16 65529799 missense possibly damaging 0.80
IGL02938:Pou1f1 APN 16 65523544 missense probably benign 0.00
R1780:Pou1f1 UTSW 16 65523470 missense probably benign 0.04
R4742:Pou1f1 UTSW 16 65523481 missense probably benign
R4881:Pou1f1 UTSW 16 65531842 missense probably damaging 1.00
R7404:Pou1f1 UTSW 16 65533863 missense probably damaging 1.00
R7612:Pou1f1 UTSW 16 65529925 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CTCGTGAAGTTGAAGCTAATGC -3'
(R):5'- AAAGCTTCCTCGTGTAGCTTG -3'

Sequencing Primer
(F):5'- AATGCTGTCTCTTACCCTTTCACAGG -3'
(R):5'- GTAGCTTGTGATTTCCTCCATG -3'
Posted On2016-07-06