Incidental Mutation 'R5262:Cfap53'
ID401532
Institutional Source Beutler Lab
Gene Symbol Cfap53
Ensembl Gene ENSMUSG00000035394
Gene Namecilia and flagella associated protein 53
Synonyms4933415I03Rik, Ccdc11
MMRRC Submission 042857-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.117) question?
Stock #R5262 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location74283090-74359986 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 74329459 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 425 (S425R)
Ref Sequence ENSEMBL: ENSMUSP00000110545 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000114895] [ENSMUST00000176435]
Predicted Effect probably benign
Transcript: ENSMUST00000114895
AA Change: S425R

PolyPhen 2 Score 0.389 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000110545
Gene: ENSMUSG00000035394
AA Change: S425R

DomainStartEndE-ValueType
low complexity region 131 145 N/A INTRINSIC
Pfam:TPH 160 495 1.3e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000176435
Meta Mutation Damage Score 0.0747 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.5%
Validation Efficiency 98% (61/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the CFAP53 family. It was found to be differentially expressed by the ciliated cells of frog epidermis and in skin fibroblasts from human. Mutations in this gene are associated with visceral heterotaxy-6, which implicates this gene in determination of left-right asymmetric patterning. [provided by RefSeq, Aug 2015]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ago4 T A 4: 126,496,764 D821V possibly damaging Het
Ankdd1b C A 13: 96,420,773 R384L probably damaging Het
Ces1e A G 8: 93,223,958 F65S probably damaging Het
Corin A G 5: 72,304,955 V837A probably damaging Het
Cyp2d34 A T 15: 82,618,371 V188E probably damaging Het
Defb26 A T 2: 152,507,958 M134K unknown Het
Dnah10 A C 5: 124,785,156 K2158N probably damaging Het
Dnah9 C T 11: 66,112,333 V882M probably benign Het
Dpyd C A 3: 118,797,422 Y186* probably null Het
Elovl1 G A 4: 118,430,927 probably benign Het
Fars2 T A 13: 36,342,018 I329N probably damaging Het
Gstm1 T A 3: 108,016,363 M109L probably benign Het
Gtf2e1 T C 16: 37,535,931 T80A probably damaging Het
Gtf2h2 A G 13: 100,481,848 probably benign Het
Hrh4 G T 18: 13,015,813 L77F probably damaging Het
Ifi47 A G 11: 49,095,732 T109A probably benign Het
Igsf5 G T 16: 96,391,037 E179* probably null Het
Ints8 A G 4: 11,211,916 I885T probably damaging Het
Iqgap1 T G 7: 80,726,742 I1341L probably benign Het
Kmt2b A G 7: 30,569,794 L2567P probably damaging Het
Lilrb4a T C 10: 51,493,207 probably null Het
Maip1 G A 1: 57,406,972 R67H probably damaging Het
Muc6 T A 7: 141,651,110 I254F possibly damaging Het
Nfkb1 A T 3: 135,612,412 probably null Het
Nlrp4a T C 7: 26,459,811 probably null Het
Nrap A T 19: 56,320,223 I1477N possibly damaging Het
Pdgfa A G 5: 138,993,294 S52P probably benign Het
Pou1f1 G T 16: 65,531,982 E196* probably null Het
Ppp2r5e G A 12: 75,593,271 R19W probably damaging Het
Ptn T A 6: 36,744,484 Q7L probably benign Het
Rbp3 G T 14: 33,954,850 A252S probably damaging Het
Rcor2 G T 19: 7,274,061 V313L probably damaging Het
Rtp3 A T 9: 110,986,127 probably benign Het
Ryr2 T C 13: 11,772,437 T1017A probably damaging Het
Scgb2b11 T C 7: 32,209,351 N108S probably benign Het
Sgo2b C A 8: 63,943,137 L28F probably damaging Het
Shroom3 A G 5: 92,964,573 E1850G probably damaging Het
Slc16a14 A G 1: 84,912,891 L231P probably benign Het
Slfn5 A G 11: 82,956,670 E127G possibly damaging Het
Snx16 C T 3: 10,437,832 M118I probably damaging Het
Snx21 T C 2: 164,791,821 F176L probably damaging Het
Tap2 A G 17: 34,214,016 N424S probably benign Het
Tcf7l1 T C 6: 72,636,466 probably benign Het
Trappc8 C T 18: 20,818,190 V1400I probably benign Het
Trim58 T C 11: 58,651,668 Y485H possibly damaging Het
U2af1l4 C T 7: 30,564,213 T65I probably benign Het
Ufl1 G T 4: 25,251,294 probably benign Het
Usp8 A G 2: 126,751,111 N762S probably damaging Het
Virma A T 4: 11,539,926 D1465V probably benign Het
Vmn1r48 A T 6: 90,036,034 S270T probably benign Het
Vrk2 T A 11: 26,591,697 Y9F possibly damaging Het
Wwp1 A G 4: 19,631,057 F659L probably damaging Het
Zbtb24 C T 10: 41,464,560 Q529* probably null Het
Zranb1 CTGATGATGATG CTGATGATGATGATG 7: 132,982,827 probably benign Het
Other mutations in Cfap53
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00579:Cfap53 APN 18 74305540 nonsense probably null
IGL00667:Cfap53 APN 18 74300192 missense probably damaging 1.00
IGL00917:Cfap53 APN 18 74299296 missense probably benign 0.08
R0009:Cfap53 UTSW 18 74299176 missense probably benign 0.00
R0009:Cfap53 UTSW 18 74299176 missense probably benign 0.00
R0035:Cfap53 UTSW 18 74300207 missense probably damaging 1.00
R0035:Cfap53 UTSW 18 74300207 missense probably damaging 1.00
R0048:Cfap53 UTSW 18 74299173 missense probably benign 0.09
R0601:Cfap53 UTSW 18 74300150 missense possibly damaging 0.94
R0939:Cfap53 UTSW 18 74305730 missense probably null 0.72
R1166:Cfap53 UTSW 18 74300180 missense possibly damaging 0.68
R1588:Cfap53 UTSW 18 74307373 missense probably benign
R2105:Cfap53 UTSW 18 74283223 missense possibly damaging 0.73
R2186:Cfap53 UTSW 18 74329505 splice site probably null
R3723:Cfap53 UTSW 18 74359569 missense probably benign 0.13
R3724:Cfap53 UTSW 18 74359569 missense probably benign 0.13
R3904:Cfap53 UTSW 18 74307374 missense probably damaging 0.99
R5156:Cfap53 UTSW 18 74359767 utr 3 prime probably benign
R5928:Cfap53 UTSW 18 74359740 missense possibly damaging 0.90
R6405:Cfap53 UTSW 18 74359606 missense probably damaging 1.00
R6653:Cfap53 UTSW 18 74300209 missense probably damaging 0.97
R6675:Cfap53 UTSW 18 74307376 critical splice donor site probably null
R7011:Cfap53 UTSW 18 74329493 missense probably benign 0.13
R7397:Cfap53 UTSW 18 74283223 missense possibly damaging 0.73
Z1177:Cfap53 UTSW 18 74305552 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGATCCAAGATCCTCTCCAGC -3'
(R):5'- CCACCCCTGAATCTTTGGAAG -3'

Sequencing Primer
(F):5'- TCCAGCAATTCTAGAGACAACGTGG -3'
(R):5'- GAGAACGCAATGGTACCT -3'
Posted On2016-07-06