Incidental Mutation 'R5263:Cop1'
ID401536
Institutional Source Beutler Lab
Gene Symbol Cop1
Ensembl Gene ENSMUSG00000040782
Gene NameCOP1, E3 ubiquitin ligase
SynonymsCop1
MMRRC Submission 042831-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.440) question?
Stock #R5263 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location159232320-159347640 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 159324937 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Asparagine at position 586 (D586N)
Ref Sequence ENSEMBL: ENSMUSP00000076160 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076894]
Predicted Effect probably damaging
Transcript: ENSMUST00000076894
AA Change: D586N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000076160
Gene: ENSMUSG00000040782
AA Change: D586N

DomainStartEndE-ValueType
low complexity region 2 87 N/A INTRINSIC
low complexity region 98 112 N/A INTRINSIC
RING 138 175 3.69e-8 SMART
coiled coil region 235 305 N/A INTRINSIC
WD40 412 451 1.72e0 SMART
WD40 462 501 3.4e-2 SMART
WD40 504 544 3.42e-7 SMART
WD40 547 586 6.79e-2 SMART
WD40 590 628 1.9e-5 SMART
WD40 631 670 4.46e-1 SMART
Predicted Effect unknown
Transcript: ENSMUST00000192044
AA Change: D125N
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192597
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194798
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a conditional allele activated in prostate epithelial cells exhibit prostate gland hyperplasia and prostate intraepithelial neoplasia due to increased cell proliferation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adh4 G T 3: 138,428,055 V309L probably benign Het
Agmo T C 12: 37,357,681 V188A probably benign Het
Aqr A G 2: 114,116,578 M1041T probably damaging Het
Arhgef4 T A 1: 34,724,997 S1111R possibly damaging Het
Ascc3 A C 10: 50,716,661 E1144D probably benign Het
Cct3 T C 3: 88,321,365 probably null Het
Cd209f T C 8: 4,104,506 T114A probably benign Het
Cgnl1 G A 9: 71,632,654 Q1103* probably null Het
Dcaf5 A G 12: 80,348,346 S350P probably damaging Het
Dhx29 T C 13: 112,948,221 C658R probably damaging Het
Dync1i1 G A 6: 5,969,446 V424I possibly damaging Het
Gfap C T 11: 102,896,930 R63Q probably damaging Het
Gm10563 CTTT CTTTATTT 4: 155,614,483 probably null Het
Gprc6a C A 10: 51,626,804 G321V probably damaging Het
Itgb4 C T 11: 115,984,157 R447W probably benign Het
Izumo1r A G 9: 14,901,680 C99R probably damaging Het
Lrp1b T C 2: 41,960,679 D102G probably damaging Het
Mettl4 G A 17: 94,740,509 Q235* probably null Het
Mmrn2 A G 14: 34,399,584 T804A probably benign Het
Mrgprb5 A G 7: 48,168,189 V266A probably damaging Het
Ntng1 T C 3: 109,934,872 D195G probably damaging Het
Pld4 T C 12: 112,765,031 L206P probably damaging Het
Polr3a T C 14: 24,454,941 I1084V possibly damaging Het
Prkd1 A G 12: 50,388,306 L546P probably damaging Het
Rhob A T 12: 8,499,232 M134K probably benign Het
Ryr3 A G 2: 112,718,002 S3087P possibly damaging Het
Sema6c T C 3: 95,173,152 L887P probably benign Het
Sltm T C 9: 70,584,799 S648P unknown Het
Sucnr1 A G 3: 60,086,769 I239M possibly damaging Het
Tgtp2 T A 11: 49,059,263 M161L probably damaging Het
Trpm7 A G 2: 126,821,217 V1037A probably benign Het
Vmn2r13 A T 5: 109,173,975 H285Q probably benign Het
Zfp971 T A 2: 178,033,762 C385S probably damaging Het
Zfpm2 T A 15: 41,099,395 V283E probably benign Het
Zranb1 CTGATGATGATG CTGATGATGATGATG 7: 132,982,827 probably benign Het
Other mutations in Cop1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02572:Cop1 APN 1 159308878 unclassified probably benign
IGL02945:Cop1 APN 1 159306689 missense probably benign 0.20
IGL03059:Cop1 APN 1 159306709 missense probably damaging 1.00
R0032:Cop1 UTSW 1 159325036 critical splice donor site probably null
R0179:Cop1 UTSW 1 159250066 missense probably benign 0.20
R0846:Cop1 UTSW 1 159319816 missense probably benign 0.26
R0988:Cop1 UTSW 1 159232847 missense possibly damaging 0.76
R0988:Cop1 UTSW 1 159244672 missense probably damaging 1.00
R2296:Cop1 UTSW 1 159244650 missense possibly damaging 0.92
R2297:Cop1 UTSW 1 159252554 missense possibly damaging 0.53
R2504:Cop1 UTSW 1 159232805 missense probably damaging 0.98
R2974:Cop1 UTSW 1 159324929 missense possibly damaging 0.95
R4889:Cop1 UTSW 1 159284589 missense probably damaging 1.00
R4965:Cop1 UTSW 1 159239597 missense probably damaging 0.99
R4981:Cop1 UTSW 1 159325068 unclassified probably benign
R5124:Cop1 UTSW 1 159278112 missense probably damaging 0.96
R5268:Cop1 UTSW 1 159327164 missense probably damaging 1.00
R5470:Cop1 UTSW 1 159266860 intron probably benign
R5595:Cop1 UTSW 1 159250073 missense probably benign 0.00
R5919:Cop1 UTSW 1 159319724 missense probably damaging 1.00
R6386:Cop1 UTSW 1 159289031 missense probably damaging 1.00
R6865:Cop1 UTSW 1 159308954 missense probably damaging 1.00
R6995:Cop1 UTSW 1 159306584 missense probably damaging 1.00
R7056:Cop1 UTSW 1 159250077 missense probably damaging 0.98
R7146:Cop1 UTSW 1 159244352 intron probably null
R7242:Cop1 UTSW 1 159284548 missense probably benign 0.00
R7309:Cop1 UTSW 1 159306625 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GGCCTGGACCTAGTTTCTTC -3'
(R):5'- GCTATTTGAGAAAGTAATCCAAGGTCC -3'

Sequencing Primer
(F):5'- CTGCTTGCTTTTGTTAGGCTAAAAC -3'
(R):5'- CAAGGAGAATACTCACGC -3'
Posted On2016-07-06