Mutagenetix > Incidental Mutations

Incidental Mutation 'R5263:Aqr'

401540

Institutional Source

Beutler Lab

Gene Symbol

Aqr

Ensembl Gene

ENSMUSG00000040383

Gene Name

aquarius

Synonyms

MMRRC Submission

042831-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R5263 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

114101170-114187024 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 114116578 bp

Zygosity

Heterozygous

Amino Acid Change

Methionine to Threonine at position 1041 (M1041T)

Ref Sequence

ENSEMBL: ENSMUSP00000099602 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000043160] [ENSMUST00000102543]

Predicted Effect

probably damaging
Transcript: ENSMUST00000043160
AA Change: M1041T

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000047157
Gene: ENSMUSG00000040383
AA Change: M1041T

Domain	Start	End	E-Value	Type
Pfam:Aquarius_N	18	802	N/A	PFAM
Pfam:ResIII	797	911	8.2e-7	PFAM
Pfam:AAA_11	801	1111	9.6e-32	PFAM
Pfam:AAA_19	807	894	3.7e-11	PFAM
Pfam:AAA_12	1119	1312	2.1e-27	PFAM
low complexity region	1394	1417	N/A	INTRINSIC
low complexity region	1455	1468	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000102543
AA Change: M1041T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000099602
Gene: ENSMUSG00000040383
AA Change: M1041T

Domain	Start	End	E-Value	Type
low complexity region	43	56	N/A	INTRINSIC
low complexity region	112	124	N/A	INTRINSIC
low complexity region	762	776	N/A	INTRINSIC
Pfam:AAA_11	801	1111	3.2e-32	PFAM
Pfam:AAA_19	807	893	6.5e-11	PFAM
Pfam:AAA_12	1119	1312	2.6e-27	PFAM
low complexity region	1348	1359	N/A	INTRINSIC
low complexity region	1371	1382	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000140441

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.9%
20x: 94.4%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Homozygotes for a targeted null mutation exhibit severe defects in placental vascularization with few vessels entering the placenta and little branching. Mutants die between embryonic days 9.5 and 10.5. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 35 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adh4	G	T	3: 138,428,055	V309L	probably benign	Het
Agmo	T	C	12: 37,357,681	V188A	probably benign	Het
Arhgef4	T	A	1: 34,724,997	S1111R	possibly damaging	Het
Ascc3	A	C	10: 50,716,661	E1144D	probably benign	Het
Cct3	T	C	3: 88,321,365		probably null	Het
Cd209f	T	C	8: 4,104,506	T114A	probably benign	Het
Cgnl1	G	A	9: 71,632,654	Q1103*	probably null	Het
Cop1	G	A	1: 159,324,937	D586N	probably damaging	Het
Dcaf5	A	G	12: 80,348,346	S350P	probably damaging	Het
Dhx29	T	C	13: 112,948,221	C658R	probably damaging	Het
Dync1i1	G	A	6: 5,969,446	V424I	possibly damaging	Het
Gfap	C	T	11: 102,896,930	R63Q	probably damaging	Het
Gm10563	CTTT	CTTTATTT	4: 155,614,483		probably null	Het
Gprc6a	C	A	10: 51,626,804	G321V	probably damaging	Het
Itgb4	C	T	11: 115,984,157	R447W	probably benign	Het
Izumo1r	A	G	9: 14,901,680	C99R	probably damaging	Het
Lrp1b	T	C	2: 41,960,679	D102G	probably damaging	Het
Mettl4	G	A	17: 94,740,509	Q235*	probably null	Het
Mmrn2	A	G	14: 34,399,584	T804A	probably benign	Het
Mrgprb5	A	G	7: 48,168,189	V266A	probably damaging	Het
Ntng1	T	C	3: 109,934,872	D195G	probably damaging	Het
Pld4	T	C	12: 112,765,031	L206P	probably damaging	Het
Polr3a	T	C	14: 24,454,941	I1084V	possibly damaging	Het
Prkd1	A	G	12: 50,388,306	L546P	probably damaging	Het
Rhob	A	T	12: 8,499,232	M134K	probably benign	Het
Ryr3	A	G	2: 112,718,002	S3087P	possibly damaging	Het
Sema6c	T	C	3: 95,173,152	L887P	probably benign	Het
Sltm	T	C	9: 70,584,799	S648P	unknown	Het
Sucnr1	A	G	3: 60,086,769	I239M	possibly damaging	Het
Tgtp2	T	A	11: 49,059,263	M161L	probably damaging	Het
Trpm7	A	G	2: 126,821,217	V1037A	probably benign	Het
Vmn2r13	A	T	5: 109,173,975	H285Q	probably benign	Het
Zfp971	T	A	2: 178,033,762	C385S	probably damaging	Het
Zfpm2	T	A	15: 41,099,395	V283E	probably benign	Het
Zranb1	CTGATGATGATG	CTGATGATGATGATG	7: 132,982,827		probably benign	Het

Other mutations in Aqr

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00572:Aqr	APN	2	114125942	missense	possibly damaging	0.90
IGL00694:Aqr	APN	2	114151525	missense	probably damaging	1.00
IGL02113:Aqr	APN	2	114120027	nonsense	probably null
IGL02297:Aqr	APN	2	114150481	missense	probably benign	0.24
IGL02380:Aqr	APN	2	114109936	missense	probably damaging	1.00
IGL02410:Aqr	APN	2	114136917	missense	possibly damaging	0.85
IGL02413:Aqr	APN	2	114118780	missense	possibly damaging	0.87
IGL02474:Aqr	APN	2	114112646	missense	probably damaging	1.00
IGL02941:Aqr	APN	2	114113354	missense	probably damaging	1.00
IGL02981:Aqr	APN	2	114134824	splice site	probably benign
IGL03001:Aqr	APN	2	114146919	missense	probably benign
IGL03092:Aqr	APN	2	114158943	missense	probably benign	0.38
IGL03222:Aqr	APN	2	114121256	missense	probably damaging	1.00
capricorn	UTSW	2	114105882	missense	probably damaging	1.00
Goat	UTSW	2	114157575	missense	probably damaging	1.00
Pliades	UTSW	2	114132976	missense	probably damaging	1.00
sagittarius	UTSW	2	114149016	missense	probably damaging	1.00
Zodiac	UTSW	2	114108109	missense	probably damaging	0.96
PIT4531001:Aqr	UTSW	2	114130734	missense	possibly damaging	0.94
R0103:Aqr	UTSW	2	114149016	missense	probably damaging	1.00
R0103:Aqr	UTSW	2	114149016	missense	probably damaging	1.00
R0152:Aqr	UTSW	2	114159010	missense	probably benign	0.07
R0352:Aqr	UTSW	2	114170052	missense	probably damaging	1.00
R0371:Aqr	UTSW	2	114157604	missense	possibly damaging	0.80
R0374:Aqr	UTSW	2	114130611	missense	probably damaging	1.00
R0550:Aqr	UTSW	2	114132976	missense	probably damaging	1.00
R0604:Aqr	UTSW	2	114130604	missense	probably benign	0.00
R0685:Aqr	UTSW	2	114140977	missense	probably damaging	1.00
R1236:Aqr	UTSW	2	114116655	missense	probably damaging	1.00
R1434:Aqr	UTSW	2	114150409	missense	probably damaging	1.00
R1806:Aqr	UTSW	2	114161652	missense	probably damaging	1.00
R2154:Aqr	UTSW	2	114137004	missense	probably damaging	1.00
R2185:Aqr	UTSW	2	114130534	critical splice donor site	probably null
R2377:Aqr	UTSW	2	114140940	missense	possibly damaging	0.58
R2862:Aqr	UTSW	2	114136917	missense	probably damaging	1.00
R3615:Aqr	UTSW	2	114136887	missense	probably damaging	1.00
R3616:Aqr	UTSW	2	114136887	missense	probably damaging	1.00
R3713:Aqr	UTSW	2	114118669	splice site	probably benign
R3715:Aqr	UTSW	2	114118669	splice site	probably benign
R4586:Aqr	UTSW	2	114112577	missense	probably benign	0.06
R4663:Aqr	UTSW	2	114161666	nonsense	probably null
R4809:Aqr	UTSW	2	114175214	utr 5 prime	probably benign
R4887:Aqr	UTSW	2	114150509	missense	probably damaging	1.00
R4888:Aqr	UTSW	2	114150509	missense	probably damaging	1.00
R4952:Aqr	UTSW	2	114109937	missense	probably damaging	1.00
R4974:Aqr	UTSW	2	114113351	missense	probably damaging	1.00
R5050:Aqr	UTSW	2	114112609	nonsense	probably null
R5050:Aqr	UTSW	2	114170025	critical splice donor site	probably null
R5213:Aqr	UTSW	2	114113327	missense	probably damaging	1.00
R5470:Aqr	UTSW	2	114157575	missense	probably damaging	1.00
R5488:Aqr	UTSW	2	114133073	missense	probably damaging	1.00
R5489:Aqr	UTSW	2	114133073	missense	probably damaging	1.00
R5567:Aqr	UTSW	2	114148970	missense	probably damaging	1.00
R5570:Aqr	UTSW	2	114148970	missense	probably damaging	1.00
R5641:Aqr	UTSW	2	114149034	missense	probably damaging	1.00
R5685:Aqr	UTSW	2	114156265	missense	possibly damaging	0.87
R5963:Aqr	UTSW	2	114126961	missense	probably damaging	1.00
R5992:Aqr	UTSW	2	114143049	nonsense	probably null
R6015:Aqr	UTSW	2	114175165	start codon destroyed	probably null	0.53
R6253:Aqr	UTSW	2	114156277	missense	possibly damaging	0.93
R6264:Aqr	UTSW	2	114109964	missense	probably damaging	1.00
R6773:Aqr	UTSW	2	114148996	missense	possibly damaging	0.64
R6877:Aqr	UTSW	2	114116571	nonsense	probably null
R7211:Aqr	UTSW	2	114134723	missense	probably benign	0.01
R7232:Aqr	UTSW	2	114105882	missense	probably damaging	1.00
R7308:Aqr	UTSW	2	114104062	missense	possibly damaging	0.86
R7396:Aqr	UTSW	2	114119946	nonsense	probably null
R7490:Aqr	UTSW	2	114158868	critical splice donor site	probably null
R7526:Aqr	UTSW	2	114108109	missense	probably damaging	0.96
R7629:Aqr	UTSW	2	114114593	missense	probably damaging	1.00
R7828:Aqr	UTSW	2	114149016	missense	probably damaging	1.00
R8037:Aqr	UTSW	2	114161680	missense	probably damaging	1.00
R8166:Aqr	UTSW	2	114113325	missense	possibly damaging	0.95
R8712:Aqr	UTSW	2	114118877	missense	probably damaging	1.00
Z1176:Aqr	UTSW	2	114108122	missense	probably damaging	0.98
Z1176:Aqr	UTSW	2	114109991	missense	probably benign	0.25

Predicted Primers

PCR Primer
(F):5'- AACCTTAAGAATGACGGTCTGG -3'
(R):5'- TCAAGAATTGTCTGACTGGGC -3'

Sequencing Primer
(F):5'- GGTCTGGTAAGACAATCAAG -3'
(R):5'- CAGATTGTGCCTGGATACACATAAAC -3'

Posted On

2016-07-06