Incidental Mutation 'R5263:Sucnr1'
ID401543
Institutional Source Beutler Lab
Gene Symbol Sucnr1
Ensembl Gene ENSMUSG00000027762
Gene Namesuccinate receptor 1
SynonymsGpr91
MMRRC Submission 042831-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.067) question?
Stock #R5263 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location60081869-60087566 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 60086769 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Methionine at position 239 (I239M)
Ref Sequence ENSEMBL: ENSMUSP00000029326 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029326]
Predicted Effect possibly damaging
Transcript: ENSMUST00000029326
AA Change: I239M

PolyPhen 2 Score 0.683 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000029326
Gene: ENSMUSG00000027762
AA Change: I239M

DomainStartEndE-ValueType
Pfam:7tm_1 36 290 9.3e-38 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195544
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a G-protein-coupled receptor for succinate, an intermediate molecule of the citric acid cycle. It is involved in the promotion of hematopoietic progenitor cell development, and it has a potential role in renovascular hypertension which has known correlations to renal failure, diabetes and atherosclerosis. [provided by RefSeq, Oct 2009]
PHENOTYPE: Mice homozygous for a knockout allele exhibit decreased renin plasma and kidney levels upon high-glucose stimulation in a diabetic or non-diabetic model. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adh4 G T 3: 138,428,055 V309L probably benign Het
Agmo T C 12: 37,357,681 V188A probably benign Het
Aqr A G 2: 114,116,578 M1041T probably damaging Het
Arhgef4 T A 1: 34,724,997 S1111R possibly damaging Het
Ascc3 A C 10: 50,716,661 E1144D probably benign Het
Cct3 T C 3: 88,321,365 probably null Het
Cd209f T C 8: 4,104,506 T114A probably benign Het
Cgnl1 G A 9: 71,632,654 Q1103* probably null Het
Cop1 G A 1: 159,324,937 D586N probably damaging Het
Dcaf5 A G 12: 80,348,346 S350P probably damaging Het
Dhx29 T C 13: 112,948,221 C658R probably damaging Het
Dync1i1 G A 6: 5,969,446 V424I possibly damaging Het
Gfap C T 11: 102,896,930 R63Q probably damaging Het
Gm10563 CTTT CTTTATTT 4: 155,614,483 probably null Het
Gprc6a C A 10: 51,626,804 G321V probably damaging Het
Itgb4 C T 11: 115,984,157 R447W probably benign Het
Izumo1r A G 9: 14,901,680 C99R probably damaging Het
Lrp1b T C 2: 41,960,679 D102G probably damaging Het
Mettl4 G A 17: 94,740,509 Q235* probably null Het
Mmrn2 A G 14: 34,399,584 T804A probably benign Het
Mrgprb5 A G 7: 48,168,189 V266A probably damaging Het
Ntng1 T C 3: 109,934,872 D195G probably damaging Het
Pld4 T C 12: 112,765,031 L206P probably damaging Het
Polr3a T C 14: 24,454,941 I1084V possibly damaging Het
Prkd1 A G 12: 50,388,306 L546P probably damaging Het
Rhob A T 12: 8,499,232 M134K probably benign Het
Ryr3 A G 2: 112,718,002 S3087P possibly damaging Het
Sema6c T C 3: 95,173,152 L887P probably benign Het
Sltm T C 9: 70,584,799 S648P unknown Het
Tgtp2 T A 11: 49,059,263 M161L probably damaging Het
Trpm7 A G 2: 126,821,217 V1037A probably benign Het
Vmn2r13 A T 5: 109,173,975 H285Q probably benign Het
Zfp971 T A 2: 178,033,762 C385S probably damaging Het
Zfpm2 T A 15: 41,099,395 V283E probably benign Het
Zranb1 CTGATGATGATG CTGATGATGATGATG 7: 132,982,827 probably benign Het
Other mutations in Sucnr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00340:Sucnr1 APN 3 60086632 missense probably benign 0.03
IGL01656:Sucnr1 APN 3 60086411 missense possibly damaging 0.67
IGL02096:Sucnr1 APN 3 60086950 missense possibly damaging 0.56
R0727:Sucnr1 UTSW 3 60086660 missense probably benign 0.14
R4110:Sucnr1 UTSW 3 60086794 missense probably damaging 1.00
R4112:Sucnr1 UTSW 3 60086794 missense probably damaging 1.00
R4620:Sucnr1 UTSW 3 60086769 missense possibly damaging 0.68
R4831:Sucnr1 UTSW 3 60086648 missense probably damaging 1.00
R5068:Sucnr1 UTSW 3 60086867 missense probably damaging 1.00
R6258:Sucnr1 UTSW 3 60086357 missense probably damaging 1.00
R6505:Sucnr1 UTSW 3 60086723 missense probably benign 0.23
R6574:Sucnr1 UTSW 3 60086599 missense probably damaging 1.00
R7022:Sucnr1 UTSW 3 60086278 missense probably benign 0.03
R7072:Sucnr1 UTSW 3 60086183 missense probably damaging 1.00
R7439:Sucnr1 UTSW 3 60086696 missense probably benign
R8098:Sucnr1 UTSW 3 60086741 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATTTACAGCCTCTGCCTGAC -3'
(R):5'- AGCAGCTCATGTCCTGAAGG -3'

Sequencing Primer
(F):5'- GACTTTGTTGGGCTTCCTAATTC -3'
(R):5'- AATCAGCATCTCTCTGTAATGGTC -3'
Posted On2016-07-06