Incidental Mutation 'R5263:Sema6c'
ID401544
Institutional Source Beutler Lab
Gene Symbol Sema6c
Ensembl Gene ENSMUSG00000038777
Gene Namesema domain, transmembrane domain (TM), and cytoplasmic domain, (semaphorin) 6C
SynonymsSema Y, Semay
MMRRC Submission 042831-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.464) question?
Stock #R5263 (G1)
Quality Score115
Status Not validated
Chromosome3
Chromosomal Location95160457-95174024 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 95173152 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 887 (L887P)
Ref Sequence ENSEMBL: ENSMUSP00000144039 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090821] [ENSMUST00000090823] [ENSMUST00000107217] [ENSMUST00000131620] [ENSMUST00000142449] [ENSMUST00000168321] [ENSMUST00000202315] [ENSMUST00000204709]
Predicted Effect probably benign
Transcript: ENSMUST00000090821
AA Change: L887P

PolyPhen 2 Score 0.019 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000088331
Gene: ENSMUSG00000038777
AA Change: L887P

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Sema 62 488 2.55e-165 SMART
transmembrane domain 604 626 N/A INTRINSIC
low complexity region 627 638 N/A INTRINSIC
low complexity region 646 658 N/A INTRINSIC
low complexity region 660 669 N/A INTRINSIC
low complexity region 693 709 N/A INTRINSIC
low complexity region 744 761 N/A INTRINSIC
low complexity region 907 924 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000090823
AA Change: L919P

PolyPhen 2 Score 0.019 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000088333
Gene: ENSMUSG00000038777
AA Change: L919P

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Sema 62 488 2.55e-165 SMART
low complexity region 591 603 N/A INTRINSIC
transmembrane domain 636 658 N/A INTRINSIC
low complexity region 659 670 N/A INTRINSIC
low complexity region 678 690 N/A INTRINSIC
low complexity region 692 701 N/A INTRINSIC
low complexity region 725 741 N/A INTRINSIC
low complexity region 776 793 N/A INTRINSIC
low complexity region 939 956 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107217
AA Change: L879P

PolyPhen 2 Score 0.019 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000102835
Gene: ENSMUSG00000038777
AA Change: L879P

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Sema 62 448 1.23e-126 SMART
low complexity region 551 563 N/A INTRINSIC
transmembrane domain 596 618 N/A INTRINSIC
low complexity region 619 630 N/A INTRINSIC
low complexity region 638 650 N/A INTRINSIC
low complexity region 652 661 N/A INTRINSIC
low complexity region 685 701 N/A INTRINSIC
low complexity region 736 753 N/A INTRINSIC
low complexity region 899 916 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126597
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130662
Predicted Effect probably benign
Transcript: ENSMUST00000131620
SMART Domains Protein: ENSMUSP00000138154
Gene: ENSMUSG00000038777

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134125
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141607
Predicted Effect probably benign
Transcript: ENSMUST00000142449
SMART Domains Protein: ENSMUSP00000123457
Gene: ENSMUSG00000038777

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Sema 62 488 2.55e-165 SMART
low complexity region 591 603 N/A INTRINSIC
transmembrane domain 636 658 N/A INTRINSIC
low complexity region 659 670 N/A INTRINSIC
low complexity region 678 690 N/A INTRINSIC
low complexity region 692 701 N/A INTRINSIC
low complexity region 725 741 N/A INTRINSIC
low complexity region 776 793 N/A INTRINSIC
low complexity region 939 956 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000168321
AA Change: L919P

PolyPhen 2 Score 0.019 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000129081
Gene: ENSMUSG00000038777
AA Change: L919P

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Sema 62 488 2.55e-165 SMART
transmembrane domain 604 626 N/A INTRINSIC
low complexity region 627 638 N/A INTRINSIC
low complexity region 646 658 N/A INTRINSIC
low complexity region 660 669 N/A INTRINSIC
low complexity region 693 709 N/A INTRINSIC
low complexity region 744 761 N/A INTRINSIC
low complexity region 907 924 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000202315
AA Change: L887P

PolyPhen 2 Score 0.019 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000144039
Gene: ENSMUSG00000038777
AA Change: L887P

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Sema 62 488 2.55e-165 SMART
transmembrane domain 604 626 N/A INTRINSIC
low complexity region 627 638 N/A INTRINSIC
low complexity region 646 658 N/A INTRINSIC
low complexity region 660 669 N/A INTRINSIC
low complexity region 693 709 N/A INTRINSIC
low complexity region 744 761 N/A INTRINSIC
low complexity region 907 924 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000204709
SMART Domains Protein: ENSMUSP00000144702
Gene: ENSMUSG00000038777

DomainStartEndE-ValueType
low complexity region 10 20 N/A INTRINSIC
PDB:3OKY|B 25 117 8e-8 PDB
Blast:Sema 62 119 9e-34 BLAST
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the semaphorin family. Semaphorins represent important molecular signals controlling multiple aspects of the cellular response that follows CNS injury, and thus may play an important role in neural regeneration. [provided by RefSeq, May 2010]
PHENOTYPE: Mice homozygous for a targeted mutation display a decrease in pain threshold. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adh4 G T 3: 138,428,055 V309L probably benign Het
Agmo T C 12: 37,357,681 V188A probably benign Het
Aqr A G 2: 114,116,578 M1041T probably damaging Het
Arhgef4 T A 1: 34,724,997 S1111R possibly damaging Het
Ascc3 A C 10: 50,716,661 E1144D probably benign Het
Cct3 T C 3: 88,321,365 probably null Het
Cd209f T C 8: 4,104,506 T114A probably benign Het
Cgnl1 G A 9: 71,632,654 Q1103* probably null Het
Cop1 G A 1: 159,324,937 D586N probably damaging Het
Dcaf5 A G 12: 80,348,346 S350P probably damaging Het
Dhx29 T C 13: 112,948,221 C658R probably damaging Het
Dync1i1 G A 6: 5,969,446 V424I possibly damaging Het
Gfap C T 11: 102,896,930 R63Q probably damaging Het
Gm10563 CTTT CTTTATTT 4: 155,614,483 probably null Het
Gprc6a C A 10: 51,626,804 G321V probably damaging Het
Itgb4 C T 11: 115,984,157 R447W probably benign Het
Izumo1r A G 9: 14,901,680 C99R probably damaging Het
Lrp1b T C 2: 41,960,679 D102G probably damaging Het
Mettl4 G A 17: 94,740,509 Q235* probably null Het
Mmrn2 A G 14: 34,399,584 T804A probably benign Het
Mrgprb5 A G 7: 48,168,189 V266A probably damaging Het
Ntng1 T C 3: 109,934,872 D195G probably damaging Het
Pld4 T C 12: 112,765,031 L206P probably damaging Het
Polr3a T C 14: 24,454,941 I1084V possibly damaging Het
Prkd1 A G 12: 50,388,306 L546P probably damaging Het
Rhob A T 12: 8,499,232 M134K probably benign Het
Ryr3 A G 2: 112,718,002 S3087P possibly damaging Het
Sltm T C 9: 70,584,799 S648P unknown Het
Sucnr1 A G 3: 60,086,769 I239M possibly damaging Het
Tgtp2 T A 11: 49,059,263 M161L probably damaging Het
Trpm7 A G 2: 126,821,217 V1037A probably benign Het
Vmn2r13 A T 5: 109,173,975 H285Q probably benign Het
Zfp971 T A 2: 178,033,762 C385S probably damaging Het
Zfpm2 T A 15: 41,099,395 V283E probably benign Het
Zranb1 CTGATGATGATG CTGATGATGATGATG 7: 132,982,827 probably benign Het
Other mutations in Sema6c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01547:Sema6c APN 3 95172398 missense probably damaging 1.00
IGL01631:Sema6c APN 3 95170403 missense probably benign 0.10
IGL01799:Sema6c APN 3 95170831 missense probably damaging 1.00
IGL02237:Sema6c APN 3 95170119 missense probably damaging 1.00
IGL02852:Sema6c APN 3 95169984 splice site probably benign
IGL02874:Sema6c APN 3 95170377 missense probably damaging 1.00
IGL03003:Sema6c APN 3 95169614 missense probably damaging 1.00
BB005:Sema6c UTSW 3 95172309 missense probably damaging 1.00
BB015:Sema6c UTSW 3 95172309 missense probably damaging 1.00
PIT4418001:Sema6c UTSW 3 95170090 missense possibly damaging 0.57
R0558:Sema6c UTSW 3 95168691 missense probably damaging 1.00
R0582:Sema6c UTSW 3 95169197 missense probably damaging 1.00
R0590:Sema6c UTSW 3 95172623 missense probably damaging 1.00
R0685:Sema6c UTSW 3 95172710 missense possibly damaging 0.46
R1056:Sema6c UTSW 3 95171216 missense probably benign 0.15
R1721:Sema6c UTSW 3 95170788 missense probably damaging 0.98
R1867:Sema6c UTSW 3 95170788 missense probably damaging 0.98
R1868:Sema6c UTSW 3 95170813 missense probably damaging 0.99
R2016:Sema6c UTSW 3 95171234 missense probably benign 0.00
R2343:Sema6c UTSW 3 95167083 missense probably damaging 1.00
R2898:Sema6c UTSW 3 95172818 missense probably damaging 1.00
R4095:Sema6c UTSW 3 95173194 missense probably benign 0.03
R4999:Sema6c UTSW 3 95168363 missense probably damaging 1.00
R6914:Sema6c UTSW 3 95173208 missense probably benign 0.00
R6942:Sema6c UTSW 3 95173208 missense probably benign 0.00
R7104:Sema6c UTSW 3 95168845 missense possibly damaging 0.95
R7524:Sema6c UTSW 3 95167060 missense probably benign 0.20
R7724:Sema6c UTSW 3 95173199 missense probably damaging 1.00
R7928:Sema6c UTSW 3 95172309 missense probably damaging 1.00
R8045:Sema6c UTSW 3 95173224 missense probably benign 0.27
Z1177:Sema6c UTSW 3 95168328 missense probably benign
Predicted Primers PCR Primer
(F):5'- TAGAGGTGACCACGCTGGAG -3'
(R):5'- GAGTTCCTCGCCAAAGGAC -3'

Sequencing Primer
(F):5'- AACTGCTGCGCTACCTG -3'
(R):5'- CGGGAGAGTCTCGGAGTC -3'
Posted On2016-07-06