Incidental Mutation 'R5263:Adh4'
ID401546
Institutional Source Beutler Lab
Gene Symbol Adh4
Ensembl Gene ENSMUSG00000037797
Gene Namealcohol dehydrogenase 4 (class II), pi polypeptide
SynonymsAdh2, mouse class II type ADH
MMRRC Submission 042831-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.158) question?
Stock #R5263 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location138415466-138430892 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 138428055 bp
ZygosityHeterozygous
Amino Acid Change Valine to Leucine at position 309 (V309L)
Ref Sequence ENSEMBL: ENSMUSP00000013458 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000013458] [ENSMUST00000161312]
PDB Structure
Mouse class II alcohol dehydrogenase complex with NADH [X-RAY DIFFRACTION]
Mouse class II alcohol dehydrogenase complex with NADH and inhibitor [X-RAY DIFFRACTION]
P47H MUTANT OF MOUSE CLASS II ALCOHOL DEHYDROGENASE COMPLEX WITH NADH [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000013458
AA Change: V309L

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000013458
Gene: ENSMUSG00000037797
AA Change: V309L

DomainStartEndE-ValueType
Pfam:ADH_N 34 165 3.1e-23 PFAM
Pfam:ADH_zinc_N 207 337 8.2e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000161312
SMART Domains Protein: ENSMUSP00000124163
Gene: ENSMUSG00000037797

DomainStartEndE-ValueType
Pfam:ADH_N 46 177 2.8e-25 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes class II alcohol dehydrogenase 4 pi subunit, which is a member of the alcohol dehydrogenase family. Members of this enzyme family metabolize a wide variety of substrates, including ethanol, retinol, other aliphatic alcohols, hydroxysteroids, and lipid peroxidation products. Class II alcohol dehydrogenase is a homodimer composed of 2 pi subunits. It exhibits a high activity for oxidation of long-chain aliphatic alcohols and aromatic alcohols and is less sensitive to pyrazole. This gene is localized to chromosome 4 in the cluster of alcohol dehydrogenase genes. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agmo T C 12: 37,357,681 V188A probably benign Het
Aqr A G 2: 114,116,578 M1041T probably damaging Het
Arhgef4 T A 1: 34,724,997 S1111R possibly damaging Het
Ascc3 A C 10: 50,716,661 E1144D probably benign Het
Cct3 T C 3: 88,321,365 probably null Het
Cd209f T C 8: 4,104,506 T114A probably benign Het
Cgnl1 G A 9: 71,632,654 Q1103* probably null Het
Cop1 G A 1: 159,324,937 D586N probably damaging Het
Dcaf5 A G 12: 80,348,346 S350P probably damaging Het
Dhx29 T C 13: 112,948,221 C658R probably damaging Het
Dync1i1 G A 6: 5,969,446 V424I possibly damaging Het
Gfap C T 11: 102,896,930 R63Q probably damaging Het
Gm10563 CTTT CTTTATTT 4: 155,614,483 probably null Het
Gprc6a C A 10: 51,626,804 G321V probably damaging Het
Itgb4 C T 11: 115,984,157 R447W probably benign Het
Izumo1r A G 9: 14,901,680 C99R probably damaging Het
Lrp1b T C 2: 41,960,679 D102G probably damaging Het
Mettl4 G A 17: 94,740,509 Q235* probably null Het
Mmrn2 A G 14: 34,399,584 T804A probably benign Het
Mrgprb5 A G 7: 48,168,189 V266A probably damaging Het
Ntng1 T C 3: 109,934,872 D195G probably damaging Het
Pld4 T C 12: 112,765,031 L206P probably damaging Het
Polr3a T C 14: 24,454,941 I1084V possibly damaging Het
Prkd1 A G 12: 50,388,306 L546P probably damaging Het
Rhob A T 12: 8,499,232 M134K probably benign Het
Ryr3 A G 2: 112,718,002 S3087P possibly damaging Het
Sema6c T C 3: 95,173,152 L887P probably benign Het
Sltm T C 9: 70,584,799 S648P unknown Het
Sucnr1 A G 3: 60,086,769 I239M possibly damaging Het
Tgtp2 T A 11: 49,059,263 M161L probably damaging Het
Trpm7 A G 2: 126,821,217 V1037A probably benign Het
Vmn2r13 A T 5: 109,173,975 H285Q probably benign Het
Zfp971 T A 2: 178,033,762 C385S probably damaging Het
Zfpm2 T A 15: 41,099,395 V283E probably benign Het
Zranb1 CTGATGATGATG CTGATGATGATGATG 7: 132,982,827 probably benign Het
Other mutations in Adh4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00592:Adh4 APN 3 138420636 missense probably damaging 0.99
IGL01450:Adh4 APN 3 138424033 missense probably benign 0.05
IGL01608:Adh4 APN 3 138429027 unclassified probably benign
IGL01618:Adh4 APN 3 138429027 unclassified probably benign
IGL01621:Adh4 APN 3 138429027 unclassified probably benign
IGL01640:Adh4 APN 3 138429027 unclassified probably benign
IGL01979:Adh4 APN 3 138429027 unclassified probably benign
IGL01982:Adh4 APN 3 138429027 unclassified probably benign
IGL01993:Adh4 APN 3 138429027 unclassified probably benign
IGL02720:Adh4 APN 3 138419220 missense possibly damaging 0.87
IGL03030:Adh4 APN 3 138429145 missense probably benign 0.13
PIT4403001:Adh4 UTSW 3 138424178 missense probably damaging 0.97
R0295:Adh4 UTSW 3 138429076 missense probably damaging 1.00
R0308:Adh4 UTSW 3 138424102 missense probably damaging 1.00
R0636:Adh4 UTSW 3 138428074 missense probably damaging 1.00
R1450:Adh4 UTSW 3 138424174 missense probably damaging 1.00
R4824:Adh4 UTSW 3 138429046 missense possibly damaging 0.81
R5137:Adh4 UTSW 3 138422235 missense probably benign 0.00
R5566:Adh4 UTSW 3 138424189 missense probably damaging 1.00
R6162:Adh4 UTSW 3 138415489 unclassified probably null
R7297:Adh4 UTSW 3 138429140 missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- TCCCGGGAGCACTGTATATAG -3'
(R):5'- GTTGATTGGTTCATTTCAATACCAC -3'

Sequencing Primer
(F):5'- CGGGAGCACTGTATATAGTCACAC -3'
(R):5'- TAGGCTTGCATCACTAAGCTCAG -3'
Posted On2016-07-06