Incidental Mutation 'R5263:Vmn2r13'
ID 401549
Institutional Source Beutler Lab
Gene Symbol Vmn2r13
Ensembl Gene ENSMUSG00000091635
Gene Name vomeronasal 2, receptor 13
Synonyms Gm4867
MMRRC Submission 042831-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.086) question?
Stock # R5263 (G1)
Quality Score 225
Status Not validated
Chromosome 5
Chromosomal Location 109156068-109192107 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 109173975 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Histidine to Glutamine at position 285 (H285Q)
Ref Sequence ENSEMBL: ENSMUSP00000052977 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053253]
AlphaFold L7N1X2
Predicted Effect probably benign
Transcript: ENSMUST00000053253
AA Change: H285Q

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000052977
Gene: ENSMUSG00000091635
AA Change: H285Q

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:ANF_receptor 76 463 2.8e-29 PFAM
Pfam:NCD3G 506 560 1.3e-18 PFAM
Pfam:7tm_3 593 828 1.8e-54 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adh4 G T 3: 138,428,055 V309L probably benign Het
Agmo T C 12: 37,357,681 V188A probably benign Het
Aqr A G 2: 114,116,578 M1041T probably damaging Het
Arhgef4 T A 1: 34,724,997 S1111R possibly damaging Het
Ascc3 A C 10: 50,716,661 E1144D probably benign Het
Cct3 T C 3: 88,321,365 probably null Het
Cd209f T C 8: 4,104,506 T114A probably benign Het
Cgnl1 G A 9: 71,632,654 Q1103* probably null Het
Cop1 G A 1: 159,324,937 D586N probably damaging Het
Dcaf5 A G 12: 80,348,346 S350P probably damaging Het
Dhx29 T C 13: 112,948,221 C658R probably damaging Het
Dync1i1 G A 6: 5,969,446 V424I possibly damaging Het
Gfap C T 11: 102,896,930 R63Q probably damaging Het
Gm10563 CTTT CTTTATTT 4: 155,614,483 probably null Het
Gprc6a C A 10: 51,626,804 G321V probably damaging Het
Itgb4 C T 11: 115,984,157 R447W probably benign Het
Izumo1r A G 9: 14,901,680 C99R probably damaging Het
Lrp1b T C 2: 41,960,679 D102G probably damaging Het
Mettl4 G A 17: 94,740,509 Q235* probably null Het
Mmrn2 A G 14: 34,399,584 T804A probably benign Het
Mrgprb5 A G 7: 48,168,189 V266A probably damaging Het
Ntng1 T C 3: 109,934,872 D195G probably damaging Het
Pld4 T C 12: 112,765,031 L206P probably damaging Het
Polr3a T C 14: 24,454,941 I1084V possibly damaging Het
Prkd1 A G 12: 50,388,306 L546P probably damaging Het
Rhob A T 12: 8,499,232 M134K probably benign Het
Ryr3 A G 2: 112,718,002 S3087P possibly damaging Het
Sema6c T C 3: 95,173,152 L887P probably benign Het
Sltm T C 9: 70,584,799 S648P unknown Het
Sucnr1 A G 3: 60,086,769 I239M possibly damaging Het
Tgtp2 T A 11: 49,059,263 M161L probably damaging Het
Trpm7 A G 2: 126,821,217 V1037A probably benign Het
Zfp971 T A 2: 178,033,762 C385S probably damaging Het
Zfpm2 T A 15: 41,099,395 V283E probably benign Het
Zranb1 CTGATGATGATG CTGATGATGATGATG 7: 132,982,827 probably benign Het
Other mutations in Vmn2r13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00965:Vmn2r13 APN 5 109156098 missense probably damaging 1.00
IGL01373:Vmn2r13 APN 5 109156702 missense probably damaging 1.00
IGL01946:Vmn2r13 APN 5 109174219 missense probably benign 0.01
IGL01971:Vmn2r13 APN 5 109174115 missense probably benign 0.01
IGL02636:Vmn2r13 APN 5 109192017 missense probably damaging 0.98
IGL03062:Vmn2r13 APN 5 109156282 missense probably damaging 1.00
IGL03173:Vmn2r13 APN 5 109171779 missense possibly damaging 0.95
IGL03301:Vmn2r13 APN 5 109158089 missense probably damaging 0.99
IGL03383:Vmn2r13 APN 5 109156532 missense probably damaging 0.98
IGL03048:Vmn2r13 UTSW 5 109156285 missense probably damaging 1.00
R0123:Vmn2r13 UTSW 5 109175049 missense probably benign 0.00
R0134:Vmn2r13 UTSW 5 109175049 missense probably benign 0.00
R0220:Vmn2r13 UTSW 5 109156466 missense probably damaging 1.00
R0225:Vmn2r13 UTSW 5 109175049 missense probably benign 0.00
R0393:Vmn2r13 UTSW 5 109156529 missense probably benign 0.01
R0410:Vmn2r13 UTSW 5 109173813 missense probably benign 0.35
R0787:Vmn2r13 UTSW 5 109156847 missense probably damaging 0.99
R1200:Vmn2r13 UTSW 5 109174202 missense probably damaging 1.00
R1448:Vmn2r13 UTSW 5 109174135 missense probably damaging 1.00
R1782:Vmn2r13 UTSW 5 109158174 missense probably benign 0.08
R1939:Vmn2r13 UTSW 5 109191986 missense possibly damaging 0.88
R2029:Vmn2r13 UTSW 5 109192077 missense probably benign 0.13
R2125:Vmn2r13 UTSW 5 109158192 missense probably benign 0.00
R2126:Vmn2r13 UTSW 5 109158192 missense probably benign 0.00
R2379:Vmn2r13 UTSW 5 109171778 missense probably benign 0.05
R2680:Vmn2r13 UTSW 5 109174312 missense possibly damaging 0.66
R2888:Vmn2r13 UTSW 5 109191974 missense possibly damaging 0.88
R2889:Vmn2r13 UTSW 5 109191974 missense possibly damaging 0.88
R2890:Vmn2r13 UTSW 5 109191974 missense possibly damaging 0.88
R3014:Vmn2r13 UTSW 5 109171761 missense possibly damaging 0.81
R3683:Vmn2r13 UTSW 5 109156855 missense probably damaging 1.00
R4074:Vmn2r13 UTSW 5 109156700 missense probably damaging 1.00
R4599:Vmn2r13 UTSW 5 109156456 missense probably damaging 1.00
R4614:Vmn2r13 UTSW 5 109175199 missense probably benign 0.01
R4805:Vmn2r13 UTSW 5 109156465 missense probably damaging 1.00
R4822:Vmn2r13 UTSW 5 109174072 missense probably damaging 0.99
R4943:Vmn2r13 UTSW 5 109175049 missense probably benign 0.00
R5297:Vmn2r13 UTSW 5 109191939 missense probably benign 0.00
R5502:Vmn2r13 UTSW 5 109173714 missense probably damaging 1.00
R5554:Vmn2r13 UTSW 5 109191994 missense possibly damaging 0.49
R5563:Vmn2r13 UTSW 5 109173980 missense probably benign 0.00
R5819:Vmn2r13 UTSW 5 109174100 missense possibly damaging 0.79
R6074:Vmn2r13 UTSW 5 109174301 missense probably benign 0.04
R6416:Vmn2r13 UTSW 5 109174116 missense probably damaging 0.99
R6419:Vmn2r13 UTSW 5 109175219 missense possibly damaging 0.87
R6484:Vmn2r13 UTSW 5 109156674 nonsense probably null
R6486:Vmn2r13 UTSW 5 109156559 missense probably benign 0.05
R6545:Vmn2r13 UTSW 5 109156940 splice site probably null
R6700:Vmn2r13 UTSW 5 109175072 missense probably benign 0.00
R6897:Vmn2r13 UTSW 5 109158149 missense possibly damaging 0.90
R6957:Vmn2r13 UTSW 5 109156887 nonsense probably null
R7276:Vmn2r13 UTSW 5 109173779 missense probably damaging 1.00
R7363:Vmn2r13 UTSW 5 109192043 missense probably benign 0.03
R7443:Vmn2r13 UTSW 5 109192043 missense probably benign 0.03
R7555:Vmn2r13 UTSW 5 109171691 splice site probably null
R7607:Vmn2r13 UTSW 5 109173640 missense probably damaging 0.98
R7719:Vmn2r13 UTSW 5 109171752 missense probably benign 0.00
R8116:Vmn2r13 UTSW 5 109175060 missense probably benign 0.12
R8242:Vmn2r13 UTSW 5 109175006 missense possibly damaging 0.65
R8294:Vmn2r13 UTSW 5 109175112 missense probably benign 0.02
R8340:Vmn2r13 UTSW 5 109174140 missense probably benign 0.00
R8692:Vmn2r13 UTSW 5 109171648 missense probably benign 0.03
R8742:Vmn2r13 UTSW 5 109156397 missense probably benign 0.02
R9022:Vmn2r13 UTSW 5 109156376 missense possibly damaging 0.94
R9281:Vmn2r13 UTSW 5 109156087 missense probably damaging 1.00
R9529:Vmn2r13 UTSW 5 109156198 missense probably damaging 1.00
R9708:Vmn2r13 UTSW 5 109174141 missense probably benign 0.00
R9746:Vmn2r13 UTSW 5 109191907 critical splice donor site probably null
X0066:Vmn2r13 UTSW 5 109156219 missense probably benign 0.44
Predicted Primers PCR Primer
(F):5'- ACCCCAGTCTAGTCTCAGAAATG -3'
(R):5'- CTCAGATGATGACCAAGGTATTCAG -3'

Sequencing Primer
(F):5'- CCCAGTCTAGTCTCAGAAATGTTTAC -3'
(R):5'- GACCAAGGTATTCAGTTTCTATCAG -3'
Posted On 2016-07-06