Incidental Mutation 'R5263:Vmn2r13'
ID 401549
Institutional Source Beutler Lab
Gene Symbol Vmn2r13
Ensembl Gene ENSMUSG00000091635
Gene Name vomeronasal 2, receptor 13
Synonyms Gm4867
MMRRC Submission 042831-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.081) question?
Stock # R5263 (G1)
Quality Score 225
Status Not validated
Chromosome 5
Chromosomal Location 109303889-109339973 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 109321841 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Histidine to Glutamine at position 285 (H285Q)
Ref Sequence ENSEMBL: ENSMUSP00000052977 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053253]
AlphaFold L7N1X2
Predicted Effect probably benign
Transcript: ENSMUST00000053253
AA Change: H285Q

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000052977
Gene: ENSMUSG00000091635
AA Change: H285Q

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:ANF_receptor 76 463 2.8e-29 PFAM
Pfam:NCD3G 506 560 1.3e-18 PFAM
Pfam:7tm_3 593 828 1.8e-54 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adh4 G T 3: 138,133,816 (GRCm39) V309L probably benign Het
Agmo T C 12: 37,407,680 (GRCm39) V188A probably benign Het
Aqr A G 2: 113,947,059 (GRCm39) M1041T probably damaging Het
Arhgef4 T A 1: 34,764,078 (GRCm39) S1111R possibly damaging Het
Ascc3 A C 10: 50,592,757 (GRCm39) E1144D probably benign Het
Cct3 T C 3: 88,228,672 (GRCm39) probably null Het
Cd209f T C 8: 4,154,506 (GRCm39) T114A probably benign Het
Cgnl1 G A 9: 71,539,936 (GRCm39) Q1103* probably null Het
Cop1 G A 1: 159,152,507 (GRCm39) D586N probably damaging Het
Dcaf5 A G 12: 80,395,120 (GRCm39) S350P probably damaging Het
Dhx29 T C 13: 113,084,755 (GRCm39) C658R probably damaging Het
Dync1i1 G A 6: 5,969,446 (GRCm39) V424I possibly damaging Het
Gfap C T 11: 102,787,756 (GRCm39) R63Q probably damaging Het
Gm10563 CTTT CTTTATTT 4: 155,698,940 (GRCm39) probably null Het
Gprc6a C A 10: 51,502,900 (GRCm39) G321V probably damaging Het
Itgb4 C T 11: 115,874,983 (GRCm39) R447W probably benign Het
Izumo1r A G 9: 14,812,976 (GRCm39) C99R probably damaging Het
Lrp1b T C 2: 41,850,691 (GRCm39) D102G probably damaging Het
Mettl4 G A 17: 95,047,937 (GRCm39) Q235* probably null Het
Mmrn2 A G 14: 34,121,541 (GRCm39) T804A probably benign Het
Mrgprb5 A G 7: 47,817,937 (GRCm39) V266A probably damaging Het
Ntng1 T C 3: 109,842,188 (GRCm39) D195G probably damaging Het
Pld4 T C 12: 112,731,465 (GRCm39) L206P probably damaging Het
Polr3a T C 14: 24,505,009 (GRCm39) I1084V possibly damaging Het
Prkd1 A G 12: 50,435,089 (GRCm39) L546P probably damaging Het
Rhob A T 12: 8,549,232 (GRCm39) M134K probably benign Het
Ryr3 A G 2: 112,548,347 (GRCm39) S3087P possibly damaging Het
Sema6c T C 3: 95,080,463 (GRCm39) L887P probably benign Het
Sltm T C 9: 70,492,081 (GRCm39) S648P unknown Het
Sucnr1 A G 3: 59,994,190 (GRCm39) I239M possibly damaging Het
Tgtp2 T A 11: 48,950,090 (GRCm39) M161L probably damaging Het
Trpm7 A G 2: 126,663,137 (GRCm39) V1037A probably benign Het
Zfp971 T A 2: 177,675,555 (GRCm39) C385S probably damaging Het
Zfpm2 T A 15: 40,962,791 (GRCm39) V283E probably benign Het
Zranb1 CTGATGATGATG CTGATGATGATGATG 7: 132,584,556 (GRCm39) probably benign Het
Other mutations in Vmn2r13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00965:Vmn2r13 APN 5 109,303,964 (GRCm39) missense probably damaging 1.00
IGL01373:Vmn2r13 APN 5 109,304,568 (GRCm39) missense probably damaging 1.00
IGL01946:Vmn2r13 APN 5 109,322,085 (GRCm39) missense probably benign 0.01
IGL01971:Vmn2r13 APN 5 109,321,981 (GRCm39) missense probably benign 0.01
IGL02636:Vmn2r13 APN 5 109,339,883 (GRCm39) missense probably damaging 0.98
IGL03062:Vmn2r13 APN 5 109,304,148 (GRCm39) missense probably damaging 1.00
IGL03173:Vmn2r13 APN 5 109,319,645 (GRCm39) missense possibly damaging 0.95
IGL03301:Vmn2r13 APN 5 109,305,955 (GRCm39) missense probably damaging 0.99
IGL03383:Vmn2r13 APN 5 109,304,398 (GRCm39) missense probably damaging 0.98
IGL03048:Vmn2r13 UTSW 5 109,304,151 (GRCm39) missense probably damaging 1.00
R0123:Vmn2r13 UTSW 5 109,322,915 (GRCm39) missense probably benign 0.00
R0134:Vmn2r13 UTSW 5 109,322,915 (GRCm39) missense probably benign 0.00
R0220:Vmn2r13 UTSW 5 109,304,332 (GRCm39) missense probably damaging 1.00
R0225:Vmn2r13 UTSW 5 109,322,915 (GRCm39) missense probably benign 0.00
R0393:Vmn2r13 UTSW 5 109,304,395 (GRCm39) missense probably benign 0.01
R0410:Vmn2r13 UTSW 5 109,321,679 (GRCm39) missense probably benign 0.35
R0787:Vmn2r13 UTSW 5 109,304,713 (GRCm39) missense probably damaging 0.99
R1200:Vmn2r13 UTSW 5 109,322,068 (GRCm39) missense probably damaging 1.00
R1448:Vmn2r13 UTSW 5 109,322,001 (GRCm39) missense probably damaging 1.00
R1782:Vmn2r13 UTSW 5 109,306,040 (GRCm39) missense probably benign 0.08
R1939:Vmn2r13 UTSW 5 109,339,852 (GRCm39) missense possibly damaging 0.88
R2029:Vmn2r13 UTSW 5 109,339,943 (GRCm39) missense probably benign 0.13
R2125:Vmn2r13 UTSW 5 109,306,058 (GRCm39) missense probably benign 0.00
R2126:Vmn2r13 UTSW 5 109,306,058 (GRCm39) missense probably benign 0.00
R2379:Vmn2r13 UTSW 5 109,319,644 (GRCm39) missense probably benign 0.05
R2680:Vmn2r13 UTSW 5 109,322,178 (GRCm39) missense possibly damaging 0.66
R2888:Vmn2r13 UTSW 5 109,339,840 (GRCm39) missense possibly damaging 0.88
R2889:Vmn2r13 UTSW 5 109,339,840 (GRCm39) missense possibly damaging 0.88
R2890:Vmn2r13 UTSW 5 109,339,840 (GRCm39) missense possibly damaging 0.88
R3014:Vmn2r13 UTSW 5 109,319,627 (GRCm39) missense possibly damaging 0.81
R3683:Vmn2r13 UTSW 5 109,304,721 (GRCm39) missense probably damaging 1.00
R4074:Vmn2r13 UTSW 5 109,304,566 (GRCm39) missense probably damaging 1.00
R4599:Vmn2r13 UTSW 5 109,304,322 (GRCm39) missense probably damaging 1.00
R4614:Vmn2r13 UTSW 5 109,323,065 (GRCm39) missense probably benign 0.01
R4805:Vmn2r13 UTSW 5 109,304,331 (GRCm39) missense probably damaging 1.00
R4822:Vmn2r13 UTSW 5 109,321,938 (GRCm39) missense probably damaging 0.99
R4943:Vmn2r13 UTSW 5 109,322,915 (GRCm39) missense probably benign 0.00
R5297:Vmn2r13 UTSW 5 109,339,805 (GRCm39) missense probably benign 0.00
R5502:Vmn2r13 UTSW 5 109,321,580 (GRCm39) missense probably damaging 1.00
R5554:Vmn2r13 UTSW 5 109,339,860 (GRCm39) missense possibly damaging 0.49
R5563:Vmn2r13 UTSW 5 109,321,846 (GRCm39) missense probably benign 0.00
R5819:Vmn2r13 UTSW 5 109,321,966 (GRCm39) missense possibly damaging 0.79
R6074:Vmn2r13 UTSW 5 109,322,167 (GRCm39) missense probably benign 0.04
R6416:Vmn2r13 UTSW 5 109,321,982 (GRCm39) missense probably damaging 0.99
R6419:Vmn2r13 UTSW 5 109,323,085 (GRCm39) missense possibly damaging 0.87
R6484:Vmn2r13 UTSW 5 109,304,540 (GRCm39) nonsense probably null
R6486:Vmn2r13 UTSW 5 109,304,425 (GRCm39) missense probably benign 0.05
R6545:Vmn2r13 UTSW 5 109,304,806 (GRCm39) splice site probably null
R6700:Vmn2r13 UTSW 5 109,322,938 (GRCm39) missense probably benign 0.00
R6897:Vmn2r13 UTSW 5 109,306,015 (GRCm39) missense possibly damaging 0.90
R6957:Vmn2r13 UTSW 5 109,304,753 (GRCm39) nonsense probably null
R7276:Vmn2r13 UTSW 5 109,321,645 (GRCm39) missense probably damaging 1.00
R7363:Vmn2r13 UTSW 5 109,339,909 (GRCm39) missense probably benign 0.03
R7443:Vmn2r13 UTSW 5 109,339,909 (GRCm39) missense probably benign 0.03
R7555:Vmn2r13 UTSW 5 109,319,557 (GRCm39) splice site probably null
R7607:Vmn2r13 UTSW 5 109,321,506 (GRCm39) missense probably damaging 0.98
R7719:Vmn2r13 UTSW 5 109,319,618 (GRCm39) missense probably benign 0.00
R8116:Vmn2r13 UTSW 5 109,322,926 (GRCm39) missense probably benign 0.12
R8242:Vmn2r13 UTSW 5 109,322,872 (GRCm39) missense possibly damaging 0.65
R8294:Vmn2r13 UTSW 5 109,322,978 (GRCm39) missense probably benign 0.02
R8340:Vmn2r13 UTSW 5 109,322,006 (GRCm39) missense probably benign 0.00
R8692:Vmn2r13 UTSW 5 109,319,514 (GRCm39) missense probably benign 0.03
R8742:Vmn2r13 UTSW 5 109,304,263 (GRCm39) missense probably benign 0.02
R9022:Vmn2r13 UTSW 5 109,304,242 (GRCm39) missense possibly damaging 0.94
R9281:Vmn2r13 UTSW 5 109,303,953 (GRCm39) missense probably damaging 1.00
R9529:Vmn2r13 UTSW 5 109,304,064 (GRCm39) missense probably damaging 1.00
R9708:Vmn2r13 UTSW 5 109,322,007 (GRCm39) missense probably benign 0.00
R9746:Vmn2r13 UTSW 5 109,339,773 (GRCm39) critical splice donor site probably null
X0066:Vmn2r13 UTSW 5 109,304,085 (GRCm39) missense probably benign 0.44
Predicted Primers PCR Primer
(F):5'- ACCCCAGTCTAGTCTCAGAAATG -3'
(R):5'- CTCAGATGATGACCAAGGTATTCAG -3'

Sequencing Primer
(F):5'- CCCAGTCTAGTCTCAGAAATGTTTAC -3'
(R):5'- GACCAAGGTATTCAGTTTCTATCAG -3'
Posted On 2016-07-06