Incidental Mutation 'R5263:Dync1i1'
ID401550
Institutional Source Beutler Lab
Gene Symbol Dync1i1
Ensembl Gene ENSMUSG00000029757
Gene Namedynein cytoplasmic 1 intermediate chain 1
SynonymsIC74, Dncic1, DIC
MMRRC Submission 042831-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.643) question?
Stock #R5263 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location5725639-6028039 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 5969446 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 424 (V424I)
Ref Sequence ENSEMBL: ENSMUSP00000111218 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000115554] [ENSMUST00000115555] [ENSMUST00000115556] [ENSMUST00000115559]
Predicted Effect possibly damaging
Transcript: ENSMUST00000115554
AA Change: V415I

PolyPhen 2 Score 0.651 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000111216
Gene: ENSMUSG00000029757
AA Change: V415I

DomainStartEndE-ValueType
coiled coil region 1 44 N/A INTRINSIC
low complexity region 75 90 N/A INTRINSIC
Pfam:Dynein_IC2 105 137 3.1e-20 PFAM
low complexity region 143 150 N/A INTRINSIC
Blast:WD40 235 288 2e-26 BLAST
WD40 293 332 9.6e-2 SMART
WD40 339 382 8.91e-1 SMART
WD40 436 481 4.48e-2 SMART
WD40 484 524 6.19e-1 SMART
WD40 529 569 7.67e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000115555
AA Change: V452I

PolyPhen 2 Score 0.280 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000111217
Gene: ENSMUSG00000029757
AA Change: V452I

DomainStartEndE-ValueType
coiled coil region 1 44 N/A INTRINSIC
low complexity region 92 107 N/A INTRINSIC
Pfam:Dynein_IC2 143 173 6.9e-18 PFAM
low complexity region 180 187 N/A INTRINSIC
Blast:WD40 272 325 4e-26 BLAST
WD40 330 369 9.6e-2 SMART
WD40 376 419 8.91e-1 SMART
WD40 473 518 4.48e-2 SMART
WD40 521 561 6.19e-1 SMART
WD40 566 606 7.67e0 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000115556
AA Change: V424I

PolyPhen 2 Score 0.875 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000111218
Gene: ENSMUSG00000029757
AA Change: V424I

DomainStartEndE-ValueType
coiled coil region 1 44 N/A INTRINSIC
Pfam:Dynein_IC2 114 146 9.2e-21 PFAM
low complexity region 152 159 N/A INTRINSIC
Blast:WD40 245 297 3e-26 BLAST
WD40 302 341 9.6e-2 SMART
WD40 348 391 8.91e-1 SMART
WD40 445 490 4.48e-2 SMART
WD40 493 533 6.19e-1 SMART
WD40 538 578 7.67e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000115559
AA Change: V435I

PolyPhen 2 Score 0.159 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000111221
Gene: ENSMUSG00000029757
AA Change: V435I

DomainStartEndE-ValueType
coiled coil region 1 44 N/A INTRINSIC
low complexity region 75 90 N/A INTRINSIC
Pfam:Dynein_IC2 125 157 2e-20 PFAM
low complexity region 163 170 N/A INTRINSIC
Blast:WD40 256 308 3e-26 BLAST
WD40 313 352 9.6e-2 SMART
WD40 359 402 8.91e-1 SMART
WD40 456 501 4.48e-2 SMART
WD40 504 544 6.19e-1 SMART
WD40 549 589 7.67e0 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130004
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adh4 G T 3: 138,428,055 V309L probably benign Het
Agmo T C 12: 37,357,681 V188A probably benign Het
Aqr A G 2: 114,116,578 M1041T probably damaging Het
Arhgef4 T A 1: 34,724,997 S1111R possibly damaging Het
Ascc3 A C 10: 50,716,661 E1144D probably benign Het
Cct3 T C 3: 88,321,365 probably null Het
Cd209f T C 8: 4,104,506 T114A probably benign Het
Cgnl1 G A 9: 71,632,654 Q1103* probably null Het
Cop1 G A 1: 159,324,937 D586N probably damaging Het
Dcaf5 A G 12: 80,348,346 S350P probably damaging Het
Dhx29 T C 13: 112,948,221 C658R probably damaging Het
Gfap C T 11: 102,896,930 R63Q probably damaging Het
Gm10563 CTTT CTTTATTT 4: 155,614,483 probably null Het
Gprc6a C A 10: 51,626,804 G321V probably damaging Het
Itgb4 C T 11: 115,984,157 R447W probably benign Het
Izumo1r A G 9: 14,901,680 C99R probably damaging Het
Lrp1b T C 2: 41,960,679 D102G probably damaging Het
Mettl4 G A 17: 94,740,509 Q235* probably null Het
Mmrn2 A G 14: 34,399,584 T804A probably benign Het
Mrgprb5 A G 7: 48,168,189 V266A probably damaging Het
Ntng1 T C 3: 109,934,872 D195G probably damaging Het
Pld4 T C 12: 112,765,031 L206P probably damaging Het
Polr3a T C 14: 24,454,941 I1084V possibly damaging Het
Prkd1 A G 12: 50,388,306 L546P probably damaging Het
Rhob A T 12: 8,499,232 M134K probably benign Het
Ryr3 A G 2: 112,718,002 S3087P possibly damaging Het
Sema6c T C 3: 95,173,152 L887P probably benign Het
Sltm T C 9: 70,584,799 S648P unknown Het
Sucnr1 A G 3: 60,086,769 I239M possibly damaging Het
Tgtp2 T A 11: 49,059,263 M161L probably damaging Het
Trpm7 A G 2: 126,821,217 V1037A probably benign Het
Vmn2r13 A T 5: 109,173,975 H285Q probably benign Het
Zfp971 T A 2: 178,033,762 C385S probably damaging Het
Zfpm2 T A 15: 41,099,395 V283E probably benign Het
Zranb1 CTGATGATGATG CTGATGATGATGATG 7: 132,982,827 probably benign Het
Other mutations in Dync1i1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00468:Dync1i1 APN 6 5972135 missense probably damaging 1.00
IGL01816:Dync1i1 APN 6 5767146 critical splice donor site probably null
IGL02171:Dync1i1 APN 6 5969498 missense probably damaging 0.98
IGL02646:Dync1i1 APN 6 5767034 missense probably benign 0.12
IGL02672:Dync1i1 APN 6 5767034 missense probably benign 0.12
IGL02691:Dync1i1 APN 6 5800767 splice site probably benign
IGL02880:Dync1i1 APN 6 5966821 splice site probably null
IGL02796:Dync1i1 UTSW 6 5757385 missense probably benign 0.00
R0519:Dync1i1 UTSW 6 6027399 missense probably benign
R1404:Dync1i1 UTSW 6 5915876 missense probably damaging 1.00
R1404:Dync1i1 UTSW 6 5915876 missense probably damaging 1.00
R1499:Dync1i1 UTSW 6 5769799 splice site probably benign
R2119:Dync1i1 UTSW 6 5767096 missense probably damaging 0.97
R3177:Dync1i1 UTSW 6 5972211 critical splice donor site probably null
R3277:Dync1i1 UTSW 6 5972211 critical splice donor site probably null
R4028:Dync1i1 UTSW 6 5961842 missense probably damaging 1.00
R4058:Dync1i1 UTSW 6 5769764 missense probably damaging 0.99
R4551:Dync1i1 UTSW 6 5923206 missense probably benign 0.01
R4748:Dync1i1 UTSW 6 5767048 missense possibly damaging 0.66
R6193:Dync1i1 UTSW 6 5730679 missense probably benign 0.03
R6280:Dync1i1 UTSW 6 5972084 missense probably benign 0.00
R6933:Dync1i1 UTSW 6 5913333 missense probably damaging 1.00
R7083:Dync1i1 UTSW 6 5969429 missense probably damaging 1.00
R7347:Dync1i1 UTSW 6 5784530 makesense probably null
R7512:Dync1i1 UTSW 6 5969410 missense possibly damaging 0.88
R7543:Dync1i1 UTSW 6 5784464 missense possibly damaging 0.93
R7601:Dync1i1 UTSW 6 5905129 missense probably benign 0.19
X0010:Dync1i1 UTSW 6 5972141 missense probably benign 0.06
Z1177:Dync1i1 UTSW 6 5767057 missense probably benign
Predicted Primers PCR Primer
(F):5'- TAGCACTGTGTGAAAAGCAAAC -3'
(R):5'- GACCGATGTGTGCTTTAAGC -3'

Sequencing Primer
(F):5'- TGTGAAAAGCAAACAGACCATTTAGC -3'
(R):5'- ACCGATGTGTGCTTTAAGCTAGTAAG -3'
Posted On2016-07-06