Incidental Mutation 'R5263:Mrgprb5'
ID401551
Institutional Source Beutler Lab
Gene Symbol Mrgprb5
Ensembl Gene ENSMUSG00000070551
Gene NameMAS-related GPR, member B5
SynonymsMrgB5
MMRRC Submission 042831-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.052) question?
Stock #R5263 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location48167983-48169019 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 48168189 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 266 (V266A)
Ref Sequence ENSEMBL: ENSMUSP00000091953 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094389]
Predicted Effect probably damaging
Transcript: ENSMUST00000094389
AA Change: V266A

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000091953
Gene: ENSMUSG00000070551
AA Change: V266A

DomainStartEndE-ValueType
low complexity region 9 21 N/A INTRINSIC
Pfam:7TM_GPCR_Srx 38 217 1.4e-8 PFAM
Pfam:7tm_1 47 210 1.7e-7 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adh4 G T 3: 138,428,055 V309L probably benign Het
Agmo T C 12: 37,357,681 V188A probably benign Het
Aqr A G 2: 114,116,578 M1041T probably damaging Het
Arhgef4 T A 1: 34,724,997 S1111R possibly damaging Het
Ascc3 A C 10: 50,716,661 E1144D probably benign Het
Cct3 T C 3: 88,321,365 probably null Het
Cd209f T C 8: 4,104,506 T114A probably benign Het
Cgnl1 G A 9: 71,632,654 Q1103* probably null Het
Cop1 G A 1: 159,324,937 D586N probably damaging Het
Dcaf5 A G 12: 80,348,346 S350P probably damaging Het
Dhx29 T C 13: 112,948,221 C658R probably damaging Het
Dync1i1 G A 6: 5,969,446 V424I possibly damaging Het
Gfap C T 11: 102,896,930 R63Q probably damaging Het
Gm10563 CTTT CTTTATTT 4: 155,614,483 probably null Het
Gprc6a C A 10: 51,626,804 G321V probably damaging Het
Itgb4 C T 11: 115,984,157 R447W probably benign Het
Izumo1r A G 9: 14,901,680 C99R probably damaging Het
Lrp1b T C 2: 41,960,679 D102G probably damaging Het
Mettl4 G A 17: 94,740,509 Q235* probably null Het
Mmrn2 A G 14: 34,399,584 T804A probably benign Het
Ntng1 T C 3: 109,934,872 D195G probably damaging Het
Pld4 T C 12: 112,765,031 L206P probably damaging Het
Polr3a T C 14: 24,454,941 I1084V possibly damaging Het
Prkd1 A G 12: 50,388,306 L546P probably damaging Het
Rhob A T 12: 8,499,232 M134K probably benign Het
Ryr3 A G 2: 112,718,002 S3087P possibly damaging Het
Sema6c T C 3: 95,173,152 L887P probably benign Het
Sltm T C 9: 70,584,799 S648P unknown Het
Sucnr1 A G 3: 60,086,769 I239M possibly damaging Het
Tgtp2 T A 11: 49,059,263 M161L probably damaging Het
Trpm7 A G 2: 126,821,217 V1037A probably benign Het
Vmn2r13 A T 5: 109,173,975 H285Q probably benign Het
Zfp971 T A 2: 178,033,762 C385S probably damaging Het
Zfpm2 T A 15: 41,099,395 V283E probably benign Het
Zranb1 CTGATGATGATG CTGATGATGATGATG 7: 132,982,827 probably benign Het
Other mutations in Mrgprb5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01516:Mrgprb5 APN 7 48168384 missense probably damaging 1.00
IGL01662:Mrgprb5 APN 7 48168424 missense probably benign 0.02
IGL01752:Mrgprb5 APN 7 48168667 missense probably benign 0.22
IGL02117:Mrgprb5 APN 7 48168994 utr 5 prime probably benign
IGL02866:Mrgprb5 APN 7 48168166 missense probably damaging 0.99
IGL03382:Mrgprb5 APN 7 48168694 missense probably benign 0.01
R0545:Mrgprb5 UTSW 7 48168885 missense probably benign 0.08
R1389:Mrgprb5 UTSW 7 48168330 missense probably damaging 1.00
R1939:Mrgprb5 UTSW 7 48168938 missense probably benign 0.00
R2277:Mrgprb5 UTSW 7 48168831 missense probably damaging 1.00
R2367:Mrgprb5 UTSW 7 48168599 nonsense probably null
R2912:Mrgprb5 UTSW 7 48168067 missense probably benign
R2968:Mrgprb5 UTSW 7 48168569 missense probably damaging 0.98
R2969:Mrgprb5 UTSW 7 48168569 missense probably damaging 0.98
R2970:Mrgprb5 UTSW 7 48168569 missense probably damaging 0.98
R3499:Mrgprb5 UTSW 7 48168913 missense probably benign 0.04
R3828:Mrgprb5 UTSW 7 48168091 missense probably benign 0.01
R4590:Mrgprb5 UTSW 7 48168061 missense probably benign 0.16
R4719:Mrgprb5 UTSW 7 48168778 missense probably damaging 1.00
R5264:Mrgprb5 UTSW 7 48168048 missense probably benign 0.10
R5644:Mrgprb5 UTSW 7 48168207 missense probably benign 0.00
R6485:Mrgprb5 UTSW 7 48168777 missense probably damaging 0.99
R6713:Mrgprb5 UTSW 7 48168789 missense probably damaging 0.98
R7112:Mrgprb5 UTSW 7 48168907 missense probably benign
R7176:Mrgprb5 UTSW 7 48168311 missense possibly damaging 0.68
R7446:Mrgprb5 UTSW 7 48168504 missense possibly damaging 0.65
R7640:Mrgprb5 UTSW 7 48168259 missense probably benign 0.00
R7831:Mrgprb5 UTSW 7 48168249 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- TGTCTGATCAAAGACTCACTCAAC -3'
(R):5'- GCCCTGTTGGTCAAGATGATC -3'

Sequencing Primer
(F):5'- TGATCAAAGACTCACTCAACTACTG -3'
(R):5'- TGGTCAAGATGATCTGTGGATC -3'
Posted On2016-07-06