Incidental Mutation 'R5263:Cd209f'
ID401553
Institutional Source Beutler Lab
Gene Symbol Cd209f
Ensembl Gene ENSMUSG00000051906
Gene NameCD209f antigen
Synonyms1810029C22Rik, SIGNR8
MMRRC Submission 042831-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.080) question?
Stock #R5263 (G1)
Quality Score214
Status Not validated
Chromosome8
Chromosomal Location4102787-4105835 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 4104506 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 114 (T114A)
Ref Sequence ENSEMBL: ENSMUSP00000116355 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000138439] [ENSMUST00000145007]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128568
Predicted Effect probably benign
Transcript: ENSMUST00000138439
AA Change: T114A

PolyPhen 2 Score 0.161 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000119810
Gene: ENSMUSG00000051906
AA Change: T114A

DomainStartEndE-ValueType
transmembrane domain 45 67 N/A INTRINSIC
low complexity region 76 88 N/A INTRINSIC
low complexity region 105 112 N/A INTRINSIC
CLECT 146 265 1.6e-32 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000145007
AA Change: T114A

PolyPhen 2 Score 0.422 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000116355
Gene: ENSMUSG00000051906
AA Change: T114A

DomainStartEndE-ValueType
transmembrane domain 45 67 N/A INTRINSIC
low complexity region 76 88 N/A INTRINSIC
low complexity region 105 112 N/A INTRINSIC
CLECT 127 246 1.6e-32 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156276
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207294
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adh4 G T 3: 138,428,055 V309L probably benign Het
Agmo T C 12: 37,357,681 V188A probably benign Het
Aqr A G 2: 114,116,578 M1041T probably damaging Het
Arhgef4 T A 1: 34,724,997 S1111R possibly damaging Het
Ascc3 A C 10: 50,716,661 E1144D probably benign Het
Cct3 T C 3: 88,321,365 probably null Het
Cgnl1 G A 9: 71,632,654 Q1103* probably null Het
Cop1 G A 1: 159,324,937 D586N probably damaging Het
Dcaf5 A G 12: 80,348,346 S350P probably damaging Het
Dhx29 T C 13: 112,948,221 C658R probably damaging Het
Dync1i1 G A 6: 5,969,446 V424I possibly damaging Het
Gfap C T 11: 102,896,930 R63Q probably damaging Het
Gm10563 CTTT CTTTATTT 4: 155,614,483 probably null Het
Gprc6a C A 10: 51,626,804 G321V probably damaging Het
Itgb4 C T 11: 115,984,157 R447W probably benign Het
Izumo1r A G 9: 14,901,680 C99R probably damaging Het
Lrp1b T C 2: 41,960,679 D102G probably damaging Het
Mettl4 G A 17: 94,740,509 Q235* probably null Het
Mmrn2 A G 14: 34,399,584 T804A probably benign Het
Mrgprb5 A G 7: 48,168,189 V266A probably damaging Het
Ntng1 T C 3: 109,934,872 D195G probably damaging Het
Pld4 T C 12: 112,765,031 L206P probably damaging Het
Polr3a T C 14: 24,454,941 I1084V possibly damaging Het
Prkd1 A G 12: 50,388,306 L546P probably damaging Het
Rhob A T 12: 8,499,232 M134K probably benign Het
Ryr3 A G 2: 112,718,002 S3087P possibly damaging Het
Sema6c T C 3: 95,173,152 L887P probably benign Het
Sltm T C 9: 70,584,799 S648P unknown Het
Sucnr1 A G 3: 60,086,769 I239M possibly damaging Het
Tgtp2 T A 11: 49,059,263 M161L probably damaging Het
Trpm7 A G 2: 126,821,217 V1037A probably benign Het
Vmn2r13 A T 5: 109,173,975 H285Q probably benign Het
Zfp971 T A 2: 178,033,762 C385S probably damaging Het
Zfpm2 T A 15: 41,099,395 V283E probably benign Het
Zranb1 CTGATGATGATG CTGATGATGATGATG 7: 132,982,827 probably benign Het
Other mutations in Cd209f
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01393:Cd209f APN 8 4103154 missense probably damaging 1.00
IGL02339:Cd209f APN 8 4104483 critical splice donor site probably null
IGL02713:Cd209f APN 8 4103732 missense probably benign 0.13
R0481:Cd209f UTSW 8 4105558 splice site probably null
R1666:Cd209f UTSW 8 4104862 nonsense probably null
R1834:Cd209f UTSW 8 4104491 missense probably damaging 1.00
R1836:Cd209f UTSW 8 4104491 missense probably damaging 1.00
R1880:Cd209f UTSW 8 4105464 critical splice donor site probably null
R2096:Cd209f UTSW 8 4105537 missense probably benign 0.03
R4672:Cd209f UTSW 8 4103685 missense probably damaging 1.00
R4931:Cd209f UTSW 8 4103688 missense probably damaging 1.00
R6894:Cd209f UTSW 8 4105477 missense probably benign 0.01
R7011:Cd209f UTSW 8 4104859 missense probably benign 0.32
Predicted Primers PCR Primer
(F):5'- CTTCTGCCTTGGACCTTAGAGC -3'
(R):5'- AGTCTGAGACTCAGTGCTGTG -3'

Sequencing Primer
(F):5'- TTGGACCTTAGAGCCCAGAG -3'
(R):5'- AGACTCAGTGCTGTGGTCTG -3'
Posted On2016-07-06