Incidental Mutation 'R5263:Izumo1r'
ID401554
Institutional Source Beutler Lab
Gene Symbol Izumo1r
Ensembl Gene ENSMUSG00000031933
Gene NameIZUMO1 receptor, JUNO
SynonymsFolbp3, Folr4, Juno, 0910001L11Rik
MMRRC Submission 042831-MU
Accession Numbers
Is this an essential gene? Not available question?
Stock #R5263 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location14885814-14903949 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 14901680 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Arginine at position 99 (C99R)
Ref Sequence ENSEMBL: ENSMUSP00000118680 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034409] [ENSMUST00000069408] [ENSMUST00000117620] [ENSMUST00000121116] [ENSMUST00000148155]
Predicted Effect probably damaging
Transcript: ENSMUST00000034409
AA Change: C99R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000034409
Gene: ENSMUSG00000031933
AA Change: C99R

DomainStartEndE-ValueType
Pfam:Folate_rec 26 202 4e-60 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000069408
AA Change: C99R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000063632
Gene: ENSMUSG00000031933
AA Change: C99R

DomainStartEndE-ValueType
Pfam:Folate_rec 26 159 5e-42 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000117620
AA Change: C99R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113459
Gene: ENSMUSG00000031933
AA Change: C99R

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Folate_rec 26 170 1.2e-46 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000121116
AA Change: C99R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113387
Gene: ENSMUSG00000031933
AA Change: C99R

DomainStartEndE-ValueType
Pfam:Folate_rec 26 176 1.1e-43 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000148155
AA Change: C99R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000118680
Gene: ENSMUSG00000031933
AA Change: C99R

DomainStartEndE-ValueType
Pfam:Folate_rec 26 143 1.6e-38 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous inactivation of this gene causes female infertility. Homozygous null eggs do not fuse with normal sperm. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adh4 G T 3: 138,428,055 V309L probably benign Het
Agmo T C 12: 37,357,681 V188A probably benign Het
Aqr A G 2: 114,116,578 M1041T probably damaging Het
Arhgef4 T A 1: 34,724,997 S1111R possibly damaging Het
Ascc3 A C 10: 50,716,661 E1144D probably benign Het
Cct3 T C 3: 88,321,365 probably null Het
Cd209f T C 8: 4,104,506 T114A probably benign Het
Cgnl1 G A 9: 71,632,654 Q1103* probably null Het
Cop1 G A 1: 159,324,937 D586N probably damaging Het
Dcaf5 A G 12: 80,348,346 S350P probably damaging Het
Dhx29 T C 13: 112,948,221 C658R probably damaging Het
Dync1i1 G A 6: 5,969,446 V424I possibly damaging Het
Gfap C T 11: 102,896,930 R63Q probably damaging Het
Gm10563 CTTT CTTTATTT 4: 155,614,483 probably null Het
Gprc6a C A 10: 51,626,804 G321V probably damaging Het
Itgb4 C T 11: 115,984,157 R447W probably benign Het
Lrp1b T C 2: 41,960,679 D102G probably damaging Het
Mettl4 G A 17: 94,740,509 Q235* probably null Het
Mmrn2 A G 14: 34,399,584 T804A probably benign Het
Mrgprb5 A G 7: 48,168,189 V266A probably damaging Het
Ntng1 T C 3: 109,934,872 D195G probably damaging Het
Pld4 T C 12: 112,765,031 L206P probably damaging Het
Polr3a T C 14: 24,454,941 I1084V possibly damaging Het
Prkd1 A G 12: 50,388,306 L546P probably damaging Het
Rhob A T 12: 8,499,232 M134K probably benign Het
Ryr3 A G 2: 112,718,002 S3087P possibly damaging Het
Sema6c T C 3: 95,173,152 L887P probably benign Het
Sltm T C 9: 70,584,799 S648P unknown Het
Sucnr1 A G 3: 60,086,769 I239M possibly damaging Het
Tgtp2 T A 11: 49,059,263 M161L probably damaging Het
Trpm7 A G 2: 126,821,217 V1037A probably benign Het
Vmn2r13 A T 5: 109,173,975 H285Q probably benign Het
Zfp971 T A 2: 178,033,762 C385S probably damaging Het
Zfpm2 T A 15: 41,099,395 V283E probably benign Het
Zranb1 CTGATGATGATG CTGATGATGATGATG 7: 132,982,827 probably benign Het
Other mutations in Izumo1r
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01976:Izumo1r APN 9 14901679 missense probably damaging 1.00
R1579:Izumo1r UTSW 9 14901802 missense probably benign 0.01
R1637:Izumo1r UTSW 9 14901809 missense probably damaging 1.00
R5665:Izumo1r UTSW 9 14900849 missense probably damaging 1.00
R7874:Izumo1r UTSW 9 14900579 missense probably benign 0.38
R8082:Izumo1r UTSW 9 14894077 missense unknown
X0062:Izumo1r UTSW 9 14901793 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGACAGAGGCATTTTAGCTTCC -3'
(R):5'- AGAGGTGCTCATATCCCCTC -3'

Sequencing Primer
(F):5'- GACAGAGGCATTTTAGCTTCCTTTTC -3'
(R):5'- AGGTGCTCATATCCCCTCTCCTG -3'
Posted On2016-07-06