Incidental Mutation 'R5263:Tgtp2'
ID401560
Institutional Source Beutler Lab
Gene Symbol Tgtp2
Ensembl Gene ENSMUSG00000078921
Gene NameT cell specific GTPase 2
Synonyms
MMRRC Submission 042831-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5263 (G1)
Quality Score169
Status Not validated
Chromosome11
Chromosomal Location49057194-49064206 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 49059263 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 161 (M161L)
Ref Sequence ENSEMBL: ENSMUSP00000045025 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046745] [ENSMUST00000056759] [ENSMUST00000102785] [ENSMUST00000179282]
Predicted Effect probably damaging
Transcript: ENSMUST00000046745
AA Change: M161L

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000045025
Gene: ENSMUSG00000078921
AA Change: M161L

DomainStartEndE-ValueType
Pfam:IIGP 22 395 2.9e-178 PFAM
Pfam:MMR_HSR1 58 217 5.1e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000056759
SMART Domains Protein: ENSMUSP00000058544
Gene: ENSMUSG00000040328

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 4 227 5.7e-7 PFAM
Pfam:7tm_1 10 259 1.5e-33 PFAM
Pfam:7tm_4 108 252 1.7e-46 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000102785
SMART Domains Protein: ENSMUSP00000099846
Gene: ENSMUSG00000040328

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 4 227 5.7e-7 PFAM
Pfam:7tm_1 10 259 1.5e-33 PFAM
Pfam:7tm_4 108 252 1.7e-46 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128411
Predicted Effect probably benign
Transcript: ENSMUST00000179282
SMART Domains Protein: ENSMUSP00000136647
Gene: ENSMUSG00000040328

DomainStartEndE-ValueType
Pfam:7tm_4 1 276 3.6e-51 PFAM
Pfam:7TM_GPCR_Srsx 4 227 5.7e-7 PFAM
Pfam:7tm_1 10 259 3.8e-26 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adh4 G T 3: 138,428,055 V309L probably benign Het
Agmo T C 12: 37,357,681 V188A probably benign Het
Aqr A G 2: 114,116,578 M1041T probably damaging Het
Arhgef4 T A 1: 34,724,997 S1111R possibly damaging Het
Ascc3 A C 10: 50,716,661 E1144D probably benign Het
Cct3 T C 3: 88,321,365 probably null Het
Cd209f T C 8: 4,104,506 T114A probably benign Het
Cgnl1 G A 9: 71,632,654 Q1103* probably null Het
Cop1 G A 1: 159,324,937 D586N probably damaging Het
Dcaf5 A G 12: 80,348,346 S350P probably damaging Het
Dhx29 T C 13: 112,948,221 C658R probably damaging Het
Dync1i1 G A 6: 5,969,446 V424I possibly damaging Het
Gfap C T 11: 102,896,930 R63Q probably damaging Het
Gm10563 CTTT CTTTATTT 4: 155,614,483 probably null Het
Gprc6a C A 10: 51,626,804 G321V probably damaging Het
Itgb4 C T 11: 115,984,157 R447W probably benign Het
Izumo1r A G 9: 14,901,680 C99R probably damaging Het
Lrp1b T C 2: 41,960,679 D102G probably damaging Het
Mettl4 G A 17: 94,740,509 Q235* probably null Het
Mmrn2 A G 14: 34,399,584 T804A probably benign Het
Mrgprb5 A G 7: 48,168,189 V266A probably damaging Het
Ntng1 T C 3: 109,934,872 D195G probably damaging Het
Pld4 T C 12: 112,765,031 L206P probably damaging Het
Polr3a T C 14: 24,454,941 I1084V possibly damaging Het
Prkd1 A G 12: 50,388,306 L546P probably damaging Het
Rhob A T 12: 8,499,232 M134K probably benign Het
Ryr3 A G 2: 112,718,002 S3087P possibly damaging Het
Sema6c T C 3: 95,173,152 L887P probably benign Het
Sltm T C 9: 70,584,799 S648P unknown Het
Sucnr1 A G 3: 60,086,769 I239M possibly damaging Het
Trpm7 A G 2: 126,821,217 V1037A probably benign Het
Vmn2r13 A T 5: 109,173,975 H285Q probably benign Het
Zfp971 T A 2: 178,033,762 C385S probably damaging Het
Zfpm2 T A 15: 41,099,395 V283E probably benign Het
Zranb1 CTGATGATGATG CTGATGATGATGATG 7: 132,982,827 probably benign Het
Other mutations in Tgtp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02450:Tgtp2 APN 11 49059490 missense probably benign 0.35
Aha2016 UTSW 11 49059352 missense probably damaging 1.00
R1498:Tgtp2 UTSW 11 49059338 missense probably damaging 1.00
R1779:Tgtp2 UTSW 11 49058924 missense probably benign
R1958:Tgtp2 UTSW 11 49059092 missense probably damaging 1.00
R2402:Tgtp2 UTSW 11 49059130 missense probably benign 0.00
R2962:Tgtp2 UTSW 11 49059536 missense probably damaging 1.00
R4124:Tgtp2 UTSW 11 49059411 missense probably damaging 0.99
R4484:Tgtp2 UTSW 11 49059352 missense probably damaging 1.00
R4602:Tgtp2 UTSW 11 49058984 missense probably damaging 1.00
R4772:Tgtp2 UTSW 11 49058984 missense probably damaging 1.00
R4965:Tgtp2 UTSW 11 49059410 missense probably damaging 1.00
R5426:Tgtp2 UTSW 11 49059256 missense probably benign
R7128:Tgtp2 UTSW 11 49059308 missense possibly damaging 0.77
R7147:Tgtp2 UTSW 11 49059308 missense probably damaging 1.00
R7188:Tgtp2 UTSW 11 49059308 missense probably damaging 1.00
Z1177:Tgtp2 UTSW 11 49059351 missense probably benign 0.18
Predicted Primers PCR Primer
(F):5'- TCCAGCTTTGGGAAGTCATAC -3'
(R):5'- CTGGCGCAATAGAGACAACC -3'

Sequencing Primer
(F):5'- TCGATATATCAACGTTAGAGACTAGG -3'
(R):5'- TAGAGACAACCATGAAGAGAACTC -3'
Posted On2016-07-06