Incidental Mutation 'R5263:Gfap'
ID401561
Institutional Source Beutler Lab
Gene Symbol Gfap
Ensembl Gene ENSMUSG00000020932
Gene Nameglial fibrillary acidic protein
Synonyms
MMRRC Submission 042831-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.139) question?
Stock #R5263 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location102887336-102900912 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 102896930 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glutamine at position 63 (R63Q)
Ref Sequence ENSEMBL: ENSMUSP00000077061 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067444] [ENSMUST00000077902]
Predicted Effect probably damaging
Transcript: ENSMUST00000067444
AA Change: R63Q

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000064691
Gene: ENSMUSG00000020932
AA Change: R63Q

DomainStartEndE-ValueType
Pfam:Filament_head 2 64 1.7e-8 PFAM
Filament 65 373 2.34e-136 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000077902
AA Change: R63Q

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000077061
Gene: ENSMUSG00000020932
AA Change: R63Q

DomainStartEndE-ValueType
Pfam:Filament_head 1 64 1.6e-7 PFAM
Pfam:Filament 65 373 1e-112 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127909
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181125
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of the major intermediate filament proteins of mature astrocytes. It is used as a marker to distinguish astrocytes from other glial cells during development. Mutations in this gene cause Alexander disease, a rare disorder of astrocytes in the central nervous system. Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Oct 2008]
PHENOTYPE: Homozygotes for targeted null mutations show reduced astrocyte-associated intermediate filaments, enhanced long-term potentiation and impaired eye-blink conditioning. Aged mutants may show hydrocephaly, reduced myelination and impaired blood-brain barrier. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adh4 G T 3: 138,428,055 V309L probably benign Het
Agmo T C 12: 37,357,681 V188A probably benign Het
Aqr A G 2: 114,116,578 M1041T probably damaging Het
Arhgef4 T A 1: 34,724,997 S1111R possibly damaging Het
Ascc3 A C 10: 50,716,661 E1144D probably benign Het
Cct3 T C 3: 88,321,365 probably null Het
Cd209f T C 8: 4,104,506 T114A probably benign Het
Cgnl1 G A 9: 71,632,654 Q1103* probably null Het
Cop1 G A 1: 159,324,937 D586N probably damaging Het
Dcaf5 A G 12: 80,348,346 S350P probably damaging Het
Dhx29 T C 13: 112,948,221 C658R probably damaging Het
Dync1i1 G A 6: 5,969,446 V424I possibly damaging Het
Gm10563 CTTT CTTTATTT 4: 155,614,483 probably null Het
Gprc6a C A 10: 51,626,804 G321V probably damaging Het
Itgb4 C T 11: 115,984,157 R447W probably benign Het
Izumo1r A G 9: 14,901,680 C99R probably damaging Het
Lrp1b T C 2: 41,960,679 D102G probably damaging Het
Mettl4 G A 17: 94,740,509 Q235* probably null Het
Mmrn2 A G 14: 34,399,584 T804A probably benign Het
Mrgprb5 A G 7: 48,168,189 V266A probably damaging Het
Ntng1 T C 3: 109,934,872 D195G probably damaging Het
Pld4 T C 12: 112,765,031 L206P probably damaging Het
Polr3a T C 14: 24,454,941 I1084V possibly damaging Het
Prkd1 A G 12: 50,388,306 L546P probably damaging Het
Rhob A T 12: 8,499,232 M134K probably benign Het
Ryr3 A G 2: 112,718,002 S3087P possibly damaging Het
Sema6c T C 3: 95,173,152 L887P probably benign Het
Sltm T C 9: 70,584,799 S648P unknown Het
Sucnr1 A G 3: 60,086,769 I239M possibly damaging Het
Tgtp2 T A 11: 49,059,263 M161L probably damaging Het
Trpm7 A G 2: 126,821,217 V1037A probably benign Het
Vmn2r13 A T 5: 109,173,975 H285Q probably benign Het
Zfp971 T A 2: 178,033,762 C385S probably damaging Het
Zfpm2 T A 15: 41,099,395 V283E probably benign Het
Zranb1 CTGATGATGATG CTGATGATGATGATG 7: 132,982,827 probably benign Het
Other mutations in Gfap
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Gfap APN 11 102888718 missense possibly damaging 0.88
IGL00815:Gfap APN 11 102888690 missense possibly damaging 0.91
IGL01934:Gfap APN 11 102894460 missense probably damaging 0.97
IGL02556:Gfap APN 11 102896954 missense probably damaging 1.00
IGL03393:Gfap APN 11 102893257 critical splice acceptor site probably null
R4397:Gfap UTSW 11 102896984 missense probably benign 0.08
R4840:Gfap UTSW 11 102894388 missense probably damaging 1.00
R5306:Gfap UTSW 11 102895748 critical splice donor site probably null
R5611:Gfap UTSW 11 102897069 missense probably benign 0.00
R5646:Gfap UTSW 11 102891456 missense probably benign 0.21
R6964:Gfap UTSW 11 102896957 missense possibly damaging 0.49
R7409:Gfap UTSW 11 102894532 missense probably benign 0.03
R7410:Gfap UTSW 11 102893137 missense probably damaging 1.00
R8112:Gfap UTSW 11 102897102 missense probably benign
X0053:Gfap UTSW 11 102888715 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGTGCAAAGTTGTCCCTCTC -3'
(R):5'- TCCTCCATAAAGGCCCTGAC -3'

Sequencing Primer
(F):5'- CACTGTTGGCCGTAAGCTG -3'
(R):5'- TGACATCCCAGGAGCCAG -3'
Posted On2016-07-06