Incidental Mutation 'R5263:Agmo'
ID401564
Institutional Source Beutler Lab
Gene Symbol Agmo
Ensembl Gene ENSMUSG00000050103
Gene Namealkylglycerol monooxygenase
SynonymsA530016O06Rik, Tmem195
MMRRC Submission 042831-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.087) question?
Stock #R5263 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location37241641-37582202 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 37357681 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 188 (V188A)
Ref Sequence ENSEMBL: ENSMUSP00000125639 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049874] [ENSMUST00000159998] [ENSMUST00000160390]
Predicted Effect probably benign
Transcript: ENSMUST00000049874
AA Change: V188A

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000051441
Gene: ENSMUSG00000050103
AA Change: V188A

DomainStartEndE-ValueType
transmembrane domain 44 61 N/A INTRINSIC
Pfam:FA_hydroxylase 117 249 2.5e-29 PFAM
transmembrane domain 364 383 N/A INTRINSIC
transmembrane domain 411 433 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000159998
AA Change: V188A

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000123801
Gene: ENSMUSG00000050103
AA Change: V188A

DomainStartEndE-ValueType
transmembrane domain 44 61 N/A INTRINSIC
Pfam:FA_hydroxylase 117 226 7e-21 PFAM
transmembrane domain 364 383 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160158
Predicted Effect probably benign
Transcript: ENSMUST00000160390
AA Change: V188A

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000125639
Gene: ENSMUSG00000050103
AA Change: V188A

DomainStartEndE-ValueType
transmembrane domain 44 61 N/A INTRINSIC
Pfam:FA_hydroxylase 117 226 7.1e-21 PFAM
transmembrane domain 364 383 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a tetrahydrobiopterin- and iron-dependent enzyme that cleaves the ether bond of alkylglycerols. Sequence comparisons distinguish this protein as forming a third, distinct class of tetrahydrobiopterin-dependent enzymes. Variations in this gene have been associated with decreased glucose-stimulated insulin response, type 2 diabetes, and susceptibility to intracranial aneurysms. [provided by RefSeq, Aug 2012]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adh4 G T 3: 138,428,055 V309L probably benign Het
Aqr A G 2: 114,116,578 M1041T probably damaging Het
Arhgef4 T A 1: 34,724,997 S1111R possibly damaging Het
Ascc3 A C 10: 50,716,661 E1144D probably benign Het
Cct3 T C 3: 88,321,365 probably null Het
Cd209f T C 8: 4,104,506 T114A probably benign Het
Cgnl1 G A 9: 71,632,654 Q1103* probably null Het
Cop1 G A 1: 159,324,937 D586N probably damaging Het
Dcaf5 A G 12: 80,348,346 S350P probably damaging Het
Dhx29 T C 13: 112,948,221 C658R probably damaging Het
Dync1i1 G A 6: 5,969,446 V424I possibly damaging Het
Gfap C T 11: 102,896,930 R63Q probably damaging Het
Gm10563 CTTT CTTTATTT 4: 155,614,483 probably null Het
Gprc6a C A 10: 51,626,804 G321V probably damaging Het
Itgb4 C T 11: 115,984,157 R447W probably benign Het
Izumo1r A G 9: 14,901,680 C99R probably damaging Het
Lrp1b T C 2: 41,960,679 D102G probably damaging Het
Mettl4 G A 17: 94,740,509 Q235* probably null Het
Mmrn2 A G 14: 34,399,584 T804A probably benign Het
Mrgprb5 A G 7: 48,168,189 V266A probably damaging Het
Ntng1 T C 3: 109,934,872 D195G probably damaging Het
Pld4 T C 12: 112,765,031 L206P probably damaging Het
Polr3a T C 14: 24,454,941 I1084V possibly damaging Het
Prkd1 A G 12: 50,388,306 L546P probably damaging Het
Rhob A T 12: 8,499,232 M134K probably benign Het
Ryr3 A G 2: 112,718,002 S3087P possibly damaging Het
Sema6c T C 3: 95,173,152 L887P probably benign Het
Sltm T C 9: 70,584,799 S648P unknown Het
Sucnr1 A G 3: 60,086,769 I239M possibly damaging Het
Tgtp2 T A 11: 49,059,263 M161L probably damaging Het
Trpm7 A G 2: 126,821,217 V1037A probably benign Het
Vmn2r13 A T 5: 109,173,975 H285Q probably benign Het
Zfp971 T A 2: 178,033,762 C385S probably damaging Het
Zfpm2 T A 15: 41,099,395 V283E probably benign Het
Zranb1 CTGATGATGATG CTGATGATGATGATG 7: 132,982,827 probably benign Het
Other mutations in Agmo
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00988:Agmo APN 12 37357717 missense probably damaging 1.00
IGL01412:Agmo APN 12 37402141 missense possibly damaging 0.49
IGL01682:Agmo APN 12 37357627 splice site probably benign
IGL02263:Agmo APN 12 37357697 missense probably damaging 1.00
IGL02478:Agmo APN 12 37401986 missense probably damaging 1.00
IGL02803:Agmo APN 12 37252481 missense probably benign 0.00
R0664:Agmo UTSW 12 37252572 missense probably damaging 1.00
R2158:Agmo UTSW 12 37357710 missense probably damaging 1.00
R3440:Agmo UTSW 12 37243800 missense probably damaging 1.00
R6249:Agmo UTSW 12 37243838 critical splice donor site probably null
R6251:Agmo UTSW 12 37252539 missense probably damaging 1.00
R7513:Agmo UTSW 12 37244353 missense probably benign 0.01
R7686:Agmo UTSW 12 37419974 missense probably benign 0.00
R7729:Agmo UTSW 12 37414975 missense probably benign 0.00
R7731:Agmo UTSW 12 37414940 missense probably benign 0.01
R7849:Agmo UTSW 12 37242045 missense probably benign 0.03
R7852:Agmo UTSW 12 37242052 missense possibly damaging 0.92
R7932:Agmo UTSW 12 37242045 missense probably benign 0.03
R7935:Agmo UTSW 12 37242052 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- ACTTCCAGGAAACCTATCTAGAAAGG -3'
(R):5'- GACCAACTGACTTCATTGCATC -3'

Sequencing Primer
(F):5'- TGCCAAATAGAAGACTAGTATTTGC -3'
(R):5'- ACTTCATTGCATCTTATAAACTTTGC -3'
Posted On2016-07-06