Incidental Mutation 'R5263:Dcaf5'
ID401566
Institutional Source Beutler Lab
Gene Symbol Dcaf5
Ensembl Gene ENSMUSG00000049106
Gene NameDDB1 and CUL4 associated factor 5
SynonymsWdr22, 9430020B07Rik, BCRG2, BCRP2
MMRRC Submission 042831-MU
Accession Numbers

Genbank: NM_177267; MGI: 2444785

Is this an essential gene? Possibly non essential (E-score: 0.351) question?
Stock #R5263 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location80335848-80436601 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 80348346 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 350 (S350P)
Ref Sequence ENSEMBL: ENSMUSP00000052755 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054145]
Predicted Effect probably damaging
Transcript: ENSMUST00000054145
AA Change: S350P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000052755
Gene: ENSMUSG00000049106
AA Change: S350P

DomainStartEndE-ValueType
WD40 42 82 3.32e-5 SMART
WD40 90 129 1.95e-2 SMART
WD40 132 171 1.28e-6 SMART
WD40 179 216 2.65e1 SMART
low complexity region 248 255 N/A INTRINSIC
WD40 264 308 1.66e0 SMART
WD40 322 361 2.01e-4 SMART
low complexity region 431 441 N/A INTRINSIC
low complexity region 506 518 N/A INTRINSIC
low complexity region 548 573 N/A INTRINSIC
low complexity region 623 638 N/A INTRINSIC
low complexity region 793 807 N/A INTRINSIC
low complexity region 929 941 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.4%
Validation Efficiency
Allele List at MGI

All alleles(3) : Targeted, other(2) Gene trapped(1)

Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adh4 G T 3: 138,428,055 V309L probably benign Het
Agmo T C 12: 37,357,681 V188A probably benign Het
Aqr A G 2: 114,116,578 M1041T probably damaging Het
Arhgef4 T A 1: 34,724,997 S1111R possibly damaging Het
Ascc3 A C 10: 50,716,661 E1144D probably benign Het
Cct3 T C 3: 88,321,365 probably null Het
Cd209f T C 8: 4,104,506 T114A probably benign Het
Cgnl1 G A 9: 71,632,654 Q1103* probably null Het
Cop1 G A 1: 159,324,937 D586N probably damaging Het
Dhx29 T C 13: 112,948,221 C658R probably damaging Het
Dync1i1 G A 6: 5,969,446 V424I possibly damaging Het
Gfap C T 11: 102,896,930 R63Q probably damaging Het
Gm10563 CTTT CTTTATTT 4: 155,614,483 probably null Het
Gprc6a C A 10: 51,626,804 G321V probably damaging Het
Itgb4 C T 11: 115,984,157 R447W probably benign Het
Izumo1r A G 9: 14,901,680 C99R probably damaging Het
Lrp1b T C 2: 41,960,679 D102G probably damaging Het
Mettl4 G A 17: 94,740,509 Q235* probably null Het
Mmrn2 A G 14: 34,399,584 T804A probably benign Het
Mrgprb5 A G 7: 48,168,189 V266A probably damaging Het
Ntng1 T C 3: 109,934,872 D195G probably damaging Het
Pld4 T C 12: 112,765,031 L206P probably damaging Het
Polr3a T C 14: 24,454,941 I1084V possibly damaging Het
Prkd1 A G 12: 50,388,306 L546P probably damaging Het
Rhob A T 12: 8,499,232 M134K probably benign Het
Ryr3 A G 2: 112,718,002 S3087P possibly damaging Het
Sema6c T C 3: 95,173,152 L887P probably benign Het
Sltm T C 9: 70,584,799 S648P unknown Het
Sucnr1 A G 3: 60,086,769 I239M possibly damaging Het
Tgtp2 T A 11: 49,059,263 M161L probably damaging Het
Trpm7 A G 2: 126,821,217 V1037A probably benign Het
Vmn2r13 A T 5: 109,173,975 H285Q probably benign Het
Zfp971 T A 2: 178,033,762 C385S probably damaging Het
Zfpm2 T A 15: 41,099,395 V283E probably benign Het
Zranb1 CTGATGATGATG CTGATGATGATGATG 7: 132,982,827 probably benign Het
Other mutations in Dcaf5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00094:Dcaf5 APN 12 80339323 missense probably benign 0.01
IGL00990:Dcaf5 APN 12 80338832 missense probably benign
IGL01788:Dcaf5 APN 12 80348324 missense probably damaging 1.00
IGL01865:Dcaf5 APN 12 80339314 missense probably benign 0.36
IGL02365:Dcaf5 APN 12 80398773 missense probably benign 0.01
R1160:Dcaf5 UTSW 12 80340215 missense possibly damaging 0.83
R1443:Dcaf5 UTSW 12 80364069 missense probably damaging 1.00
R1804:Dcaf5 UTSW 12 80339829 missense probably benign 0.19
R1945:Dcaf5 UTSW 12 80338694 missense probably benign 0.12
R2043:Dcaf5 UTSW 12 80340217 missense probably benign 0.03
R2104:Dcaf5 UTSW 12 80338861 missense probably benign 0.00
R4831:Dcaf5 UTSW 12 80339084 missense probably benign 0.00
R4860:Dcaf5 UTSW 12 80340232 missense probably benign 0.06
R4860:Dcaf5 UTSW 12 80340232 missense probably benign 0.06
R5257:Dcaf5 UTSW 12 80397719 missense probably damaging 1.00
R5569:Dcaf5 UTSW 12 80340201 missense probably damaging 1.00
R5597:Dcaf5 UTSW 12 80340043 missense probably damaging 0.99
R5632:Dcaf5 UTSW 12 80397752 missense probably damaging 0.98
R5779:Dcaf5 UTSW 12 80338832 missense probably benign
R5833:Dcaf5 UTSW 12 80348429 missense probably damaging 0.98
R6794:Dcaf5 UTSW 12 80398893 missense possibly damaging 0.66
R7188:Dcaf5 UTSW 12 80399958 missense probably damaging 1.00
R7238:Dcaf5 UTSW 12 80338709 missense probably benign 0.27
R7286:Dcaf5 UTSW 12 80348390 missense probably damaging 1.00
R7524:Dcaf5 UTSW 12 80376696 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- GTGTCAGGTTTACAGGCATGC -3'
(R):5'- AGATTCTGCATTCTGCTCTCATAG -3'

Sequencing Primer
(F):5'- GGTTTACAGGCATGCACCAC -3'
(R):5'- CAAAATCTCGACCCTGTTCAGAGTTG -3'
Posted On2016-07-06