Incidental Mutation 'R5263:Polr3a'
ID401569
Institutional Source Beutler Lab
Gene Symbol Polr3a
Ensembl Gene ENSMUSG00000025280
Gene Namepolymerase (RNA) III (DNA directed) polypeptide A
SynonymsRPC1, 9330175N20Rik, RPC155
MMRRC Submission 042831-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5263 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location24448696-24487058 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 24454941 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 1084 (I1084V)
Ref Sequence ENSEMBL: ENSMUSP00000026322 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026322] [ENSMUST00000223718]
Predicted Effect possibly damaging
Transcript: ENSMUST00000026322
AA Change: I1084V

PolyPhen 2 Score 0.648 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000026322
Gene: ENSMUSG00000025280
AA Change: I1084V

DomainStartEndE-ValueType
Blast:RPOLA_N 122 218 5e-43 BLAST
RPOLA_N 248 553 1.09e-176 SMART
Pfam:RNA_pol_Rpb1_4 728 834 4e-35 PFAM
Pfam:RNA_pol_Rpb1_5 841 1318 1.2e-92 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000223718
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223848
Meta Mutation Damage Score 0.1175 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is the catalytic component of RNA polymerase III, which synthesizes small RNAs. The encoded protein also acts as a sensor to detect foreign DNA and trigger an innate immune response. [provided by RefSeq, Aug 2011]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adh4 G T 3: 138,428,055 V309L probably benign Het
Agmo T C 12: 37,357,681 V188A probably benign Het
Aqr A G 2: 114,116,578 M1041T probably damaging Het
Arhgef4 T A 1: 34,724,997 S1111R possibly damaging Het
Ascc3 A C 10: 50,716,661 E1144D probably benign Het
Cct3 T C 3: 88,321,365 probably null Het
Cd209f T C 8: 4,104,506 T114A probably benign Het
Cgnl1 G A 9: 71,632,654 Q1103* probably null Het
Cop1 G A 1: 159,324,937 D586N probably damaging Het
Dcaf5 A G 12: 80,348,346 S350P probably damaging Het
Dhx29 T C 13: 112,948,221 C658R probably damaging Het
Dync1i1 G A 6: 5,969,446 V424I possibly damaging Het
Gfap C T 11: 102,896,930 R63Q probably damaging Het
Gm10563 CTTT CTTTATTT 4: 155,614,483 probably null Het
Gprc6a C A 10: 51,626,804 G321V probably damaging Het
Itgb4 C T 11: 115,984,157 R447W probably benign Het
Izumo1r A G 9: 14,901,680 C99R probably damaging Het
Lrp1b T C 2: 41,960,679 D102G probably damaging Het
Mettl4 G A 17: 94,740,509 Q235* probably null Het
Mmrn2 A G 14: 34,399,584 T804A probably benign Het
Mrgprb5 A G 7: 48,168,189 V266A probably damaging Het
Ntng1 T C 3: 109,934,872 D195G probably damaging Het
Pld4 T C 12: 112,765,031 L206P probably damaging Het
Prkd1 A G 12: 50,388,306 L546P probably damaging Het
Rhob A T 12: 8,499,232 M134K probably benign Het
Ryr3 A G 2: 112,718,002 S3087P possibly damaging Het
Sema6c T C 3: 95,173,152 L887P probably benign Het
Sltm T C 9: 70,584,799 S648P unknown Het
Sucnr1 A G 3: 60,086,769 I239M possibly damaging Het
Tgtp2 T A 11: 49,059,263 M161L probably damaging Het
Trpm7 A G 2: 126,821,217 V1037A probably benign Het
Vmn2r13 A T 5: 109,173,975 H285Q probably benign Het
Zfp971 T A 2: 178,033,762 C385S probably damaging Het
Zfpm2 T A 15: 41,099,395 V283E probably benign Het
Zranb1 CTGATGATGATG CTGATGATGATGATG 7: 132,982,827 probably benign Het
Other mutations in Polr3a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00838:Polr3a APN 14 24475863 missense probably benign 0.35
IGL00974:Polr3a APN 14 24479424 missense probably benign 0.05
IGL01348:Polr3a APN 14 24461763 missense probably damaging 1.00
IGL01464:Polr3a APN 14 24470681 splice site probably benign
IGL01785:Polr3a APN 14 24484120 nonsense probably null
IGL01786:Polr3a APN 14 24484120 nonsense probably null
IGL01936:Polr3a APN 14 24479188 missense probably damaging 1.00
IGL02095:Polr3a APN 14 24454610 missense possibly damaging 0.91
IGL02454:Polr3a APN 14 24475823 missense possibly damaging 0.87
IGL02702:Polr3a APN 14 24470877 missense probably benign 0.07
IGL02961:Polr3a APN 14 24467040 nonsense probably null
IGL03069:Polr3a APN 14 24461740 missense probably damaging 0.99
R0001:Polr3a UTSW 14 24452189 splice site probably benign
R0048:Polr3a UTSW 14 24469255 splice site probably benign
R0157:Polr3a UTSW 14 24479186 missense probably damaging 0.99
R0445:Polr3a UTSW 14 24454921 missense probably benign 0.00
R0449:Polr3a UTSW 14 24484466 missense probably damaging 0.99
R0597:Polr3a UTSW 14 24484134 missense probably benign 0.29
R0604:Polr3a UTSW 14 24484164 missense probably damaging 1.00
R0644:Polr3a UTSW 14 24484164 missense probably damaging 1.00
R0703:Polr3a UTSW 14 24484164 missense probably damaging 1.00
R0754:Polr3a UTSW 14 24484164 missense probably damaging 1.00
R0767:Polr3a UTSW 14 24484164 missense probably damaging 1.00
R0816:Polr3a UTSW 14 24484164 missense probably damaging 1.00
R0817:Polr3a UTSW 14 24484164 missense probably damaging 1.00
R0819:Polr3a UTSW 14 24484164 missense probably damaging 1.00
R0840:Polr3a UTSW 14 24452200 missense possibly damaging 0.95
R1481:Polr3a UTSW 14 24452548 missense probably null 0.98
R1644:Polr3a UTSW 14 24470624 missense probably damaging 1.00
R1699:Polr3a UTSW 14 24484164 missense probably damaging 1.00
R1704:Polr3a UTSW 14 24484120 nonsense probably null
R2363:Polr3a UTSW 14 24475892 splice site probably null
R3419:Polr3a UTSW 14 24467035 missense probably damaging 1.00
R3934:Polr3a UTSW 14 24476101 missense probably benign 0.30
R4296:Polr3a UTSW 14 24453196 missense possibly damaging 0.82
R4611:Polr3a UTSW 14 24452508 splice site probably null
R4690:Polr3a UTSW 14 24464281 missense possibly damaging 0.78
R4934:Polr3a UTSW 14 24452624 missense probably benign 0.11
R4947:Polr3a UTSW 14 24482464 missense probably benign 0.00
R5232:Polr3a UTSW 14 24453211 missense probably benign 0.00
R5264:Polr3a UTSW 14 24454941 missense possibly damaging 0.65
R5265:Polr3a UTSW 14 24454941 missense possibly damaging 0.65
R5282:Polr3a UTSW 14 24454941 missense possibly damaging 0.65
R5319:Polr3a UTSW 14 24454941 missense possibly damaging 0.65
R5321:Polr3a UTSW 14 24454941 missense possibly damaging 0.65
R5323:Polr3a UTSW 14 24454941 missense possibly damaging 0.65
R5387:Polr3a UTSW 14 24454941 missense possibly damaging 0.65
R5388:Polr3a UTSW 14 24454941 missense possibly damaging 0.65
R5401:Polr3a UTSW 14 24454941 missense possibly damaging 0.65
R5402:Polr3a UTSW 14 24454941 missense possibly damaging 0.65
R5443:Polr3a UTSW 14 24454941 missense possibly damaging 0.65
R5444:Polr3a UTSW 14 24454941 missense possibly damaging 0.65
R5725:Polr3a UTSW 14 24465387 splice site probably null
R5841:Polr3a UTSW 14 24450698 missense probably benign 0.00
R6408:Polr3a UTSW 14 24486871 critical splice donor site probably null
R6704:Polr3a UTSW 14 24461842 missense probably damaging 1.00
R7136:Polr3a UTSW 14 24461815 missense probably damaging 1.00
R7307:Polr3a UTSW 14 24459987 missense probably benign 0.03
R7368:Polr3a UTSW 14 24467076 missense probably damaging 0.98
R7800:Polr3a UTSW 14 24484387 missense probably null 0.83
Z1088:Polr3a UTSW 14 24479724 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- ATTACCCGCACTGTCATGGC -3'
(R):5'- AGTCTCAGTGAGAGGTCTGTGAC -3'

Sequencing Primer
(F):5'- GCTGCAGGCTACATCCACAG -3'
(R):5'- TGAGAGGTCTGTGACGTCCC -3'
Posted On2016-07-06