Incidental Mutation 'R5263:Mmrn2'
ID401570
Institutional Source Beutler Lab
Gene Symbol Mmrn2
Ensembl Gene ENSMUSG00000041445
Gene Namemultimerin 2
SynonymsEmilin3, EndoGlyx-1, ENDOGLYX1
MMRRC Submission 042831-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.057) question?
Stock #R5263 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location34375465-34404287 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 34399584 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 804 (T804A)
Ref Sequence ENSEMBL: ENSMUSP00000107539 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000111908]
Predicted Effect probably benign
Transcript: ENSMUST00000111908
AA Change: T804A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000107539
Gene: ENSMUSG00000041445
AA Change: T804A

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:EMI 55 127 1.1e-15 PFAM
low complexity region 174 186 N/A INTRINSIC
low complexity region 356 362 N/A INTRINSIC
coiled coil region 387 480 N/A INTRINSIC
coiled coil region 533 583 N/A INTRINSIC
coiled coil region 688 715 N/A INTRINSIC
Pfam:C1q 821 940 1.5e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000227130
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein belonging to the member of elastin microfibril interface-located (EMILIN) protein family. This family member is an extracellular matrix glycoprotein that can interfere with tumor angiogenesis and growth. It serves as a transforming growth factor beta antagonist and can interfere with the VEGF-A/VEGFR2 pathway. A related pseudogene has been identified on chromosome 6. [provided by RefSeq, Aug 2012]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adh4 G T 3: 138,428,055 V309L probably benign Het
Agmo T C 12: 37,357,681 V188A probably benign Het
Aqr A G 2: 114,116,578 M1041T probably damaging Het
Arhgef4 T A 1: 34,724,997 S1111R possibly damaging Het
Ascc3 A C 10: 50,716,661 E1144D probably benign Het
Cct3 T C 3: 88,321,365 probably null Het
Cd209f T C 8: 4,104,506 T114A probably benign Het
Cgnl1 G A 9: 71,632,654 Q1103* probably null Het
Cop1 G A 1: 159,324,937 D586N probably damaging Het
Dcaf5 A G 12: 80,348,346 S350P probably damaging Het
Dhx29 T C 13: 112,948,221 C658R probably damaging Het
Dync1i1 G A 6: 5,969,446 V424I possibly damaging Het
Gfap C T 11: 102,896,930 R63Q probably damaging Het
Gm10563 CTTT CTTTATTT 4: 155,614,483 probably null Het
Gprc6a C A 10: 51,626,804 G321V probably damaging Het
Itgb4 C T 11: 115,984,157 R447W probably benign Het
Izumo1r A G 9: 14,901,680 C99R probably damaging Het
Lrp1b T C 2: 41,960,679 D102G probably damaging Het
Mettl4 G A 17: 94,740,509 Q235* probably null Het
Mrgprb5 A G 7: 48,168,189 V266A probably damaging Het
Ntng1 T C 3: 109,934,872 D195G probably damaging Het
Pld4 T C 12: 112,765,031 L206P probably damaging Het
Polr3a T C 14: 24,454,941 I1084V possibly damaging Het
Prkd1 A G 12: 50,388,306 L546P probably damaging Het
Rhob A T 12: 8,499,232 M134K probably benign Het
Ryr3 A G 2: 112,718,002 S3087P possibly damaging Het
Sema6c T C 3: 95,173,152 L887P probably benign Het
Sltm T C 9: 70,584,799 S648P unknown Het
Sucnr1 A G 3: 60,086,769 I239M possibly damaging Het
Tgtp2 T A 11: 49,059,263 M161L probably damaging Het
Trpm7 A G 2: 126,821,217 V1037A probably benign Het
Vmn2r13 A T 5: 109,173,975 H285Q probably benign Het
Zfp971 T A 2: 178,033,762 C385S probably damaging Het
Zfpm2 T A 15: 41,099,395 V283E probably benign Het
Zranb1 CTGATGATGATG CTGATGATGATGATG 7: 132,982,827 probably benign Het
Other mutations in Mmrn2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01523:Mmrn2 APN 14 34403217 missense probably damaging 1.00
IGL02529:Mmrn2 APN 14 34398613 missense possibly damaging 0.74
IGL02590:Mmrn2 APN 14 34399267 nonsense probably null
P0037:Mmrn2 UTSW 14 34403065 missense probably damaging 1.00
R0323:Mmrn2 UTSW 14 34398034 missense probably damaging 0.97
R0499:Mmrn2 UTSW 14 34397956 missense probably damaging 1.00
R1073:Mmrn2 UTSW 14 34396294 critical splice donor site probably null
R1422:Mmrn2 UTSW 14 34396239 missense probably damaging 1.00
R1455:Mmrn2 UTSW 14 34399132 missense probably benign 0.00
R1584:Mmrn2 UTSW 14 34375685 missense probably benign 0.19
R1702:Mmrn2 UTSW 14 34397914 missense probably benign 0.34
R1919:Mmrn2 UTSW 14 34397643 missense probably benign 0.10
R1961:Mmrn2 UTSW 14 34398475 unclassified probably null
R2267:Mmrn2 UTSW 14 34399492 missense probably benign 0.41
R2268:Mmrn2 UTSW 14 34399492 missense probably benign 0.41
R2516:Mmrn2 UTSW 14 34398802 missense probably benign 0.12
R2571:Mmrn2 UTSW 14 34402939 missense probably damaging 0.99
R2696:Mmrn2 UTSW 14 34398415 missense probably damaging 1.00
R2892:Mmrn2 UTSW 14 34396630 missense probably benign 0.01
R2919:Mmrn2 UTSW 14 34402922 missense possibly damaging 0.72
R3611:Mmrn2 UTSW 14 34398675 missense probably benign 0.00
R3898:Mmrn2 UTSW 14 34399560 unclassified probably null
R3899:Mmrn2 UTSW 14 34399560 unclassified probably null
R3900:Mmrn2 UTSW 14 34399560 unclassified probably null
R4363:Mmrn2 UTSW 14 34397977 missense probably damaging 0.99
R4392:Mmrn2 UTSW 14 34397616 missense probably damaging 1.00
R4510:Mmrn2 UTSW 14 34403059 missense possibly damaging 0.67
R4511:Mmrn2 UTSW 14 34403059 missense possibly damaging 0.67
R4993:Mmrn2 UTSW 14 34396398 missense probably damaging 1.00
R5026:Mmrn2 UTSW 14 34399201 missense probably benign 0.07
R5478:Mmrn2 UTSW 14 34396582 missense probably benign 0.11
R5606:Mmrn2 UTSW 14 34397624 missense probably damaging 1.00
R6059:Mmrn2 UTSW 14 34397591 nonsense probably null
R6279:Mmrn2 UTSW 14 34397657 missense probably benign
R6300:Mmrn2 UTSW 14 34397657 missense probably benign
R6938:Mmrn2 UTSW 14 34398714 missense probably benign 0.22
R7491:Mmrn2 UTSW 14 34399417 missense probably damaging 1.00
R7607:Mmrn2 UTSW 14 34398940 missense possibly damaging 0.58
R7999:Mmrn2 UTSW 14 34397922 missense probably benign 0.30
R8113:Mmrn2 UTSW 14 34397636 missense probably benign 0.39
X0064:Mmrn2 UTSW 14 34399152 missense probably benign
Predicted Primers PCR Primer
(F):5'- CCTCAATAGCTCCCTTGAAGAC -3'
(R):5'- AGTGGTGGCCAATGATCCTG -3'

Sequencing Primer
(F):5'- GACCTACACAGCATGCTCTTGG -3'
(R):5'- GGTGGCCAATGATCCTGCTTTC -3'
Posted On2016-07-06