Incidental Mutation 'R5263:Mettl4'
ID401574
Institutional Source Beutler Lab
Gene Symbol Mettl4
Ensembl Gene ENSMUSG00000055660
Gene Namemethyltransferase like 4
SynonymsHsT661, A730091E08Rik, 2410198H06Rik
MMRRC Submission 042831-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.381) question?
Stock #R5263 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location94727080-94749892 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 94740509 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 235 (Q235*)
Ref Sequence ENSEMBL: ENSMUSP00000127142 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000171284]
Predicted Effect probably null
Transcript: ENSMUST00000171284
AA Change: Q235*
SMART Domains Protein: ENSMUSP00000127142
Gene: ENSMUSG00000055660
AA Change: Q235*

DomainStartEndE-ValueType
Pfam:MT-A70 280 454 9.9e-43 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adh4 G T 3: 138,428,055 V309L probably benign Het
Agmo T C 12: 37,357,681 V188A probably benign Het
Aqr A G 2: 114,116,578 M1041T probably damaging Het
Arhgef4 T A 1: 34,724,997 S1111R possibly damaging Het
Ascc3 A C 10: 50,716,661 E1144D probably benign Het
Cct3 T C 3: 88,321,365 probably null Het
Cd209f T C 8: 4,104,506 T114A probably benign Het
Cgnl1 G A 9: 71,632,654 Q1103* probably null Het
Cop1 G A 1: 159,324,937 D586N probably damaging Het
Dcaf5 A G 12: 80,348,346 S350P probably damaging Het
Dhx29 T C 13: 112,948,221 C658R probably damaging Het
Dync1i1 G A 6: 5,969,446 V424I possibly damaging Het
Gfap C T 11: 102,896,930 R63Q probably damaging Het
Gm10563 CTTT CTTTATTT 4: 155,614,483 probably null Het
Gprc6a C A 10: 51,626,804 G321V probably damaging Het
Itgb4 C T 11: 115,984,157 R447W probably benign Het
Izumo1r A G 9: 14,901,680 C99R probably damaging Het
Lrp1b T C 2: 41,960,679 D102G probably damaging Het
Mmrn2 A G 14: 34,399,584 T804A probably benign Het
Mrgprb5 A G 7: 48,168,189 V266A probably damaging Het
Ntng1 T C 3: 109,934,872 D195G probably damaging Het
Pld4 T C 12: 112,765,031 L206P probably damaging Het
Polr3a T C 14: 24,454,941 I1084V possibly damaging Het
Prkd1 A G 12: 50,388,306 L546P probably damaging Het
Rhob A T 12: 8,499,232 M134K probably benign Het
Ryr3 A G 2: 112,718,002 S3087P possibly damaging Het
Sema6c T C 3: 95,173,152 L887P probably benign Het
Sltm T C 9: 70,584,799 S648P unknown Het
Sucnr1 A G 3: 60,086,769 I239M possibly damaging Het
Tgtp2 T A 11: 49,059,263 M161L probably damaging Het
Trpm7 A G 2: 126,821,217 V1037A probably benign Het
Vmn2r13 A T 5: 109,173,975 H285Q probably benign Het
Zfp971 T A 2: 178,033,762 C385S probably damaging Het
Zfpm2 T A 15: 41,099,395 V283E probably benign Het
Zranb1 CTGATGATGATG CTGATGATGATGATG 7: 132,982,827 probably benign Het
Other mutations in Mettl4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03376:Mettl4 APN 17 94735371 missense probably damaging 1.00
R1938:Mettl4 UTSW 17 94747857 missense possibly damaging 0.76
R2172:Mettl4 UTSW 17 94733163 missense probably benign
R2370:Mettl4 UTSW 17 94733148 missense probably damaging 1.00
R3621:Mettl4 UTSW 17 94735508 missense probably damaging 1.00
R3913:Mettl4 UTSW 17 94740532 missense probably benign 0.06
R4155:Mettl4 UTSW 17 94740575 missense probably benign
R4536:Mettl4 UTSW 17 94735505 missense possibly damaging 0.79
R4946:Mettl4 UTSW 17 94740532 missense probably benign 0.06
R5397:Mettl4 UTSW 17 94727277 nonsense probably null
R6242:Mettl4 UTSW 17 94735374 missense probably damaging 1.00
R6508:Mettl4 UTSW 17 94743945 missense probably damaging 0.98
R7069:Mettl4 UTSW 17 94733633 missense probably damaging 0.98
R8088:Mettl4 UTSW 17 94735367 missense probably damaging 1.00
Z1176:Mettl4 UTSW 17 94733563 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GTAAGTCTGAACCTCTCAATTCTG -3'
(R):5'- TCAGAAGTGGTTTTCTTTACCCAC -3'

Sequencing Primer
(F):5'- TGAGATGCCAAGGCTATCCTG -3'
(R):5'- CCCACTTGTTGAAAAACAGGATG -3'
Posted On2016-07-06