Mutagenetix > Incidental Mutations

Incidental Mutation 'R5264:Ttll4'

401577

Institutional Source

Beutler Lab

Gene Symbol

Ttll4

Ensembl Gene

ENSMUSG00000033257

Gene Name

tubulin tyrosine ligase-like family, member 4

Synonyms

4632407P03Rik

MMRRC Submission

042832-MU

Accession Numbers

Genbank: NM_001014974.1; Ensembl: ENSMUST00000042125

Is this an essential gene?

Probably non essential (E-score: 0.211) question?

Stock #

R5264 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

74661745-74703730 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 74686376 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Valine at position 648 (I648V)

Ref Sequence

ENSEMBL: ENSMUSP00000109308 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000042125] [ENSMUST00000113678] [ENSMUST00000129890] [ENSMUST00000141119]

Predicted Effect

probably benign
Transcript: ENSMUST00000042125
AA Change: I648V

PolyPhen 2 Score 0.029 (Sensitivity: 0.95; Specificity: 0.82)

SMART Domains

Protein: ENSMUSP00000037406
Gene: ENSMUSG00000033257
AA Change: I648V

Domain	Start	End	E-Value	Type
low complexity region	504	544	N/A	INTRINSIC
Pfam:TTL	645	940	2.2e-106	PFAM
low complexity region	942	961	N/A	INTRINSIC
low complexity region	1103	1113	N/A	INTRINSIC
low complexity region	1168	1182	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000113678
AA Change: I648V

PolyPhen 2 Score 0.921 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000109308
Gene: ENSMUSG00000033257
AA Change: I648V

Domain	Start	End	E-Value	Type
low complexity region	504	544	N/A	INTRINSIC
Pfam:TTL	636	876	3.4e-82	PFAM
low complexity region	878	897	N/A	INTRINSIC
low complexity region	1039	1049	N/A	INTRINSIC
low complexity region	1104	1118	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000129890

SMART Domains

Protein: ENSMUSP00000119964
Gene: ENSMUSG00000033257

Domain	Start	End	E-Value	Type
low complexity region	69	101	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000140591

Predicted Effect

probably benign
Transcript: ENSMUST00000141119

SMART Domains

Protein: ENSMUSP00000116733
Gene: ENSMUSG00000033257

Domain	Start	End	E-Value	Type
low complexity region	56	96	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000143925

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000145132

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000155753

Meta Mutation Damage Score

0.1128

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.0%
20x: 94.8%

Validation Efficiency

98% (54/55)

Allele List at MGI

All alleles(20) : Targeted, other(2) Gene trapped(18)

Other mutations in this stock

Total: 46 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Casc1	A	G	6: 145,181,776	V469A	probably benign	Het
Ckap2l	A	T	2: 129,285,379	M293K	probably benign	Het
Col4a4	C	T	1: 82,493,591	G681E	unknown	Het
Efcab7	G	A	4: 99,878,170	R132H	probably benign	Het
Elovl4	T	C	9: 83,780,764	T239A	probably benign	Het
Fank1	A	G	7: 133,879,892	D240G	probably damaging	Het
Fbln5	T	A	12: 101,757,444	M346L	possibly damaging	Het
Fbxl21	T	C	13: 56,532,323	F174L	probably benign	Het
Gns	A	G	10: 121,380,185	D279G	probably benign	Het
Hmcn1	A	G	1: 150,679,514	V2502A	probably benign	Het
Itgb4	C	T	11: 115,984,157	R447W	probably benign	Het
Large2	A	G	2: 92,374,743		probably benign	Het
Lrrc8b	A	T	5: 105,480,252	I155F	probably damaging	Het
Morc2b	T	C	17: 33,138,379	I140V	probably benign	Het
Mrgprb5	G	A	7: 48,168,048	S313L	probably benign	Het
Nectin4	A	T	1: 171,383,705	T266S	probably benign	Het
Nsd1	C	T	13: 55,247,346	A1023V	possibly damaging	Het
Olfr33	T	C	7: 102,714,351	T21A	probably benign	Het
Paqr8	A	G	1: 20,935,108	H162R	possibly damaging	Het
Pclo	G	A	5: 14,676,923		probably benign	Het
Phactr4	T	C	4: 132,370,982	D325G	probably damaging	Het
Plcg2	A	T	8: 117,634,793	E1255V	possibly damaging	Het
Polr3a	T	C	14: 24,454,941	I1084V	possibly damaging	Het
Polr3b	A	T	10: 84,667,416	Q399L	probably benign	Het
Ppp1r35	G	A	5: 137,780,024		probably benign	Het
Psd3	A	T	8: 67,713,725	D919E	probably benign	Het
Ptgs2	A	G	1: 150,102,730	T198A	possibly damaging	Het
Ptpn14	T	C	1: 189,832,800		probably null	Het
Ptprk	A	G	10: 28,585,586	Y39C	probably damaging	Het
R3hdm4	A	G	10: 79,913,341	Y75H	probably benign	Het
Rsph4a	A	G	10: 33,909,383	Y430C	probably damaging	Het
Samd12	C	T	15: 53,860,273	C8Y	probably damaging	Het
Sema3e	A	C	5: 14,226,648	L314F	probably damaging	Het
Sis	A	G	3: 72,949,756	F401L	probably damaging	Het
Smoc1	T	A	12: 81,104,700	S64T	probably damaging	Het
Socs5	T	A	17: 87,134,341	H236Q	probably damaging	Het
Spaca1	C	A	4: 34,049,863	R45L	possibly damaging	Het
Spag6	A	G	2: 18,745,513	K457E	probably benign	Het
Stat2	T	A	10: 128,281,065		probably null	Het
Tcp11l2	A	G	10: 84,613,660	I496M	probably damaging	Het
Vmn2r67	T	C	7: 85,152,245	Y161C	probably damaging	Het
Wnt5b	A	T	6: 119,433,852	V171E	probably damaging	Het
Zfp236	T	C	18: 82,630,094	K933E	probably damaging	Het
Zfp236	T	C	18: 82,658,073	E373G	probably damaging	Het
Zfp617	A	G	8: 71,933,041	Y405C	probably damaging	Het
Zranb1	CTGATGATGATG	CTGATGATGATGATG	7: 132,982,827		probably benign	Het

Other mutations in Ttll4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01606:Ttll4	APN	1	74685893	missense	probably damaging	1.00
IGL01743:Ttll4	APN	1	74688193	missense	possibly damaging	0.63
IGL01914:Ttll4	APN	1	74679058	missense	probably benign	0.01
IGL02288:Ttll4	APN	1	74679401	missense	probably benign	0.05
IGL02621:Ttll4	APN	1	74687484	missense	probably damaging	1.00
IGL02662:Ttll4	APN	1	74687231	splice site	probably null
IGL02890:Ttll4	APN	1	74687339	nonsense	probably null
IGL02937:Ttll4	APN	1	74679503	missense	possibly damaging	0.92
IGL03178:Ttll4	APN	1	74680408	missense	probably damaging	0.96
IGL03412:Ttll4	APN	1	74687321	missense	probably benign	0.28
1mM(1):Ttll4	UTSW	1	74689980	missense	probably null	1.00
R0083:Ttll4	UTSW	1	74679769	missense	probably benign	0.13
R0108:Ttll4	UTSW	1	74679769	missense	probably benign	0.13
R0135:Ttll4	UTSW	1	74679928	missense	possibly damaging	0.86
R0137:Ttll4	UTSW	1	74679692	missense	possibly damaging	0.74
R0306:Ttll4	UTSW	1	74696757	missense	probably benign	0.28
R0506:Ttll4	UTSW	1	74688618	missense	probably benign	0.06
R0555:Ttll4	UTSW	1	74688280	missense	probably damaging	1.00
R1617:Ttll4	UTSW	1	74679401	missense	probably benign	0.05
R1649:Ttll4	UTSW	1	74697470	missense	possibly damaging	0.52
R1793:Ttll4	UTSW	1	74687840	missense	possibly damaging	0.91
R1898:Ttll4	UTSW	1	74697482	missense	probably benign	0.01
R1952:Ttll4	UTSW	1	74687559	missense	probably damaging	0.99
R1987:Ttll4	UTSW	1	74685368	missense	possibly damaging	0.81
R1989:Ttll4	UTSW	1	74685368	missense	possibly damaging	0.81
R2067:Ttll4	UTSW	1	74680382	missense	possibly damaging	0.94
R2162:Ttll4	UTSW	1	74686391	missense	probably damaging	1.00
R2185:Ttll4	UTSW	1	74679829	missense	possibly damaging	0.54
R2875:Ttll4	UTSW	1	74686438	splice site	probably null
R2876:Ttll4	UTSW	1	74686438	splice site	probably null
R2895:Ttll4	UTSW	1	74685358	missense	possibly damaging	0.92
R2896:Ttll4	UTSW	1	74685358	missense	possibly damaging	0.92
R3157:Ttll4	UTSW	1	74697611	missense	possibly damaging	0.81
R3832:Ttll4	UTSW	1	74686391	missense	probably damaging	1.00
R4707:Ttll4	UTSW	1	74679007	missense	possibly damaging	0.62
R4784:Ttll4	UTSW	1	74679007	missense	possibly damaging	0.62
R4785:Ttll4	UTSW	1	74679007	missense	possibly damaging	0.62
R5176:Ttll4	UTSW	1	74679286	missense	probably damaging	0.99
R5202:Ttll4	UTSW	1	74687852	critical splice donor site	probably null
R5244:Ttll4	UTSW	1	74696448	missense	probably benign	0.30
R5452:Ttll4	UTSW	1	74679321	missense	probably benign	0.06
R5992:Ttll4	UTSW	1	74685391	missense	probably damaging	1.00
R6111:Ttll4	UTSW	1	74697539	missense	possibly damaging	0.95
R6722:Ttll4	UTSW	1	74681789	missense	possibly damaging	0.95
R6776:Ttll4	UTSW	1	74681353	missense	probably damaging	1.00
R6815:Ttll4	UTSW	1	74679349	missense	possibly damaging	0.89
R6836:Ttll4	UTSW	1	74689413	missense	probably damaging	0.98
R6963:Ttll4	UTSW	1	74681816	missense	probably damaging	1.00
R7271:Ttll4	UTSW	1	74688661	missense	possibly damaging	0.83
R7508:Ttll4	UTSW	1	74687259	missense	possibly damaging	0.81
R7714:Ttll4	UTSW	1	74679413	missense	probably benign	0.00
R7837:Ttll4	UTSW	1	74681757	critical splice acceptor site	probably null
R8032:Ttll4	UTSW	1	74696473	missense	possibly damaging	0.82
R8036:Ttll4	UTSW	1	74679230	missense	probably benign	0.02
R8115:Ttll4	UTSW	1	74687330	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- GCACATTGTTCTGGTCTTGATC -3'
(R):5'- AGTGCCTCTCAAGAAATGGC -3'

Sequencing Primer
(F):5'- ATCCTAAGGCCTCATGTAGGG -3'
(R):5'- TGGCAACAGGACCCACTTTG -3'

Posted On

2016-07-06