Mutagenetix > Incidental Mutation

Incidental Mutation 'R5264:Col4a4'

401578

Institutional Source

Beutler Lab

Gene Symbol

Col4a4

Ensembl Gene

ENSMUSG00000067158

Gene Name

collagen, type IV, alpha 4

Synonyms

E130010M05Rik, [a]4(IV)

MMRRC Submission

042832-MU

Accession Numbers

Genbank: NM_007735; MGI: 104687

Essential gene?

Probably non essential (E-score: 0.083) question?

Stock #

R5264 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

82448423-82586849 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 82493591 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glycine to Glutamic Acid at position 681 (G681E)

Ref Sequence

ENSEMBL: ENSMUSP00000084282 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000087050]

AlphaFold

Q9QZR9

Predicted Effect

unknown
Transcript: ENSMUST00000087050
AA Change: G681E

SMART Domains

Protein: ENSMUSP00000084282
Gene: ENSMUSG00000067158
AA Change: G681E

Domain	Start	End	E-Value	Type
low complexity region	29	41	N/A	INTRINSIC
Pfam:Collagen	54	113	4e-11	PFAM
Pfam:Collagen	110	168	4.1e-10	PFAM
Pfam:Collagen	172	229	2.8e-10	PFAM
low complexity region	265	288	N/A	INTRINSIC
internal_repeat_7	289	345	1.46e-9	PROSPERO
internal_repeat_6	291	348	5.03e-10	PROSPERO
internal_repeat_9	297	353	7.22e-9	PROSPERO
internal_repeat_4	322	354	2.06e-11	PROSPERO
internal_repeat_11	334	349	1.25e-5	PROSPERO
Pfam:Collagen	392	449	1.3e-8	PFAM
low complexity region	461	482	N/A	INTRINSIC
Pfam:Collagen	486	553	1e-10	PFAM
low complexity region	563	595	N/A	INTRINSIC
Pfam:Collagen	597	658	1e-8	PFAM
Pfam:Collagen	663	731	4.4e-10	PFAM
Pfam:Collagen	755	810	3.3e-9	PFAM
internal_repeat_2	816	841	2.9e-13	PROSPERO
Pfam:Collagen	844	912	1.8e-10	PFAM
Pfam:Collagen	898	962	2.7e-10	PFAM
low complexity region	963	1003	N/A	INTRINSIC
Pfam:Collagen	1006	1071	2e-10	PFAM
Pfam:Collagen	1073	1132	5.8e-12	PFAM
Pfam:Collagen	1124	1185	1.8e-10	PFAM
Pfam:Collagen	1187	1245	2.3e-8	PFAM
low complexity region	1277	1361	N/A	INTRINSIC
low complexity region	1371	1384	N/A	INTRINSIC
Pfam:Collagen	1395	1454	4.3e-8	PFAM
C4	1457	1564	3.36e-58	SMART
C4	1565	1681	1.49e-59	SMART

Meta Mutation Damage Score

0.9291

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.0%
20x: 94.8%

Validation Efficiency

98% (54/55)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of the six subunits of type IV collagen, the major structural component of basement membranes. This particular collagen IV subunit, however, is only found in a subset of basement membranes. Like the other members of the type IV collagen gene family, this gene is organized in a head-to-head conformation with another type IV collagen gene so that each gene pair shares a common promoter. Mutations in this gene are associated with type II autosomal recessive Alport syndrome (hereditary glomerulonephropathy) and with familial benign hematuria (thin basement membrane disease). Two transcripts, differing only in their transcription start sites, have been identified for this gene and, as is common for collagen genes, multiple polyadenylation sites are found in the 3' UTR. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for an ENU-induced mutation develop an early nephritic syndrome associated with uremia, proteinuria, hematuria, leukocyturia, and focal segmental glomerulosclerosis, and die prematurely of kidney failure. Some homozygotes exhibit moderatesensorineural hearing loss. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 46 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Casc1	A	G	6: 145,181,776	V469A	probably benign	Het
Ckap2l	A	T	2: 129,285,379	M293K	probably benign	Het
Efcab7	G	A	4: 99,878,170	R132H	probably benign	Het
Elovl4	T	C	9: 83,780,764	T239A	probably benign	Het
Fank1	A	G	7: 133,879,892	D240G	probably damaging	Het
Fbln5	T	A	12: 101,757,444	M346L	possibly damaging	Het
Fbxl21	T	C	13: 56,532,323	F174L	probably benign	Het
Gns	A	G	10: 121,380,185	D279G	probably benign	Het
Hmcn1	A	G	1: 150,679,514	V2502A	probably benign	Het
Itgb4	C	T	11: 115,984,157	R447W	probably benign	Het
Large2	A	G	2: 92,374,743		probably benign	Het
Lrrc8b	A	T	5: 105,480,252	I155F	probably damaging	Het
Morc2b	T	C	17: 33,138,379	I140V	probably benign	Het
Mrgprb5	G	A	7: 48,168,048	S313L	probably benign	Het
Nectin4	A	T	1: 171,383,705	T266S	probably benign	Het
Nsd1	C	T	13: 55,247,346	A1023V	possibly damaging	Het
Olfr33	T	C	7: 102,714,351	T21A	probably benign	Het
Paqr8	A	G	1: 20,935,108	H162R	possibly damaging	Het
Pclo	G	A	5: 14,676,923		probably benign	Het
Phactr4	T	C	4: 132,370,982	D325G	probably damaging	Het
Plcg2	A	T	8: 117,634,793	E1255V	possibly damaging	Het
Polr3a	T	C	14: 24,454,941	I1084V	possibly damaging	Het
Polr3b	A	T	10: 84,667,416	Q399L	probably benign	Het
Ppp1r35	G	A	5: 137,780,024		probably benign	Het
Psd3	A	T	8: 67,713,725	D919E	probably benign	Het
Ptgs2	A	G	1: 150,102,730	T198A	possibly damaging	Het
Ptpn14	T	C	1: 189,832,800		probably null	Het
Ptprk	A	G	10: 28,585,586	Y39C	probably damaging	Het
R3hdm4	A	G	10: 79,913,341	Y75H	probably benign	Het
Rsph4a	A	G	10: 33,909,383	Y430C	probably damaging	Het
Samd12	C	T	15: 53,860,273	C8Y	probably damaging	Het
Sema3e	A	C	5: 14,226,648	L314F	probably damaging	Het
Sis	A	G	3: 72,949,756	F401L	probably damaging	Het
Smoc1	T	A	12: 81,104,700	S64T	probably damaging	Het
Socs5	T	A	17: 87,134,341	H236Q	probably damaging	Het
Spaca1	C	A	4: 34,049,863	R45L	possibly damaging	Het
Spag6	A	G	2: 18,745,513	K457E	probably benign	Het
Stat2	T	A	10: 128,281,065		probably null	Het
Tcp11l2	A	G	10: 84,613,660	I496M	probably damaging	Het
Ttll4	A	G	1: 74,686,376	I648V	possibly damaging	Het
Vmn2r67	T	C	7: 85,152,245	Y161C	probably damaging	Het
Wnt5b	A	T	6: 119,433,852	V171E	probably damaging	Het
Zfp236	T	C	18: 82,630,094	K933E	probably damaging	Het
Zfp236	T	C	18: 82,658,073	E373G	probably damaging	Het
Zfp617	A	G	8: 71,933,041	Y405C	probably damaging	Het
Zranb1	CTGATGATGATG	CTGATGATGATGATG	7: 132,982,827		probably benign	Het

Other mutations in Col4a4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00402:Col4a4	APN	1	82491641	missense	unknown
IGL01092:Col4a4	APN	1	82466545	missense	unknown
IGL01104:Col4a4	APN	1	82466545	missense	unknown
IGL01413:Col4a4	APN	1	82471248	missense	unknown
IGL01518:Col4a4	APN	1	82455759	missense	unknown
IGL02014:Col4a4	APN	1	82523960	splice site	probably benign
IGL02215:Col4a4	APN	1	82453809	missense	unknown
IGL02707:Col4a4	APN	1	82493516	missense	unknown
IGL02858:Col4a4	APN	1	82528483	missense	unknown
IGL02987:Col4a4	APN	1	82498925	splice site	probably benign
IGL03384:Col4a4	APN	1	82484438	missense	probably benign	0.04
amazement	UTSW	1	82480486	nonsense	probably null
aoba	UTSW	1	82535740	critical splice donor site	probably benign
asombro	UTSW	1	82489009	critical splice donor site	probably null
astonishment	UTSW	1	82455728	missense	unknown
wonderment	UTSW	1	82453144	missense	unknown
IGL02980:Col4a4	UTSW	1	82469477	critical splice donor site	probably null
R0028:Col4a4	UTSW	1	82487510	critical splice donor site	probably null
R0083:Col4a4	UTSW	1	82507111	critical splice acceptor site	probably null
R0696:Col4a4	UTSW	1	82492549	missense	unknown
R0788:Col4a4	UTSW	1	82524996	missense	unknown
R0789:Col4a4	UTSW	1	82524996	missense	unknown
R0790:Col4a4	UTSW	1	82524996	missense	unknown
R0894:Col4a4	UTSW	1	82529656	splice site	probably null
R1217:Col4a4	UTSW	1	82489009	critical splice donor site	probably null
R1465:Col4a4	UTSW	1	82497822	splice site	probably null
R1465:Col4a4	UTSW	1	82497822	splice site	probably null
R1474:Col4a4	UTSW	1	82480486	nonsense	probably null
R1508:Col4a4	UTSW	1	82455836	missense	unknown
R1640:Col4a4	UTSW	1	82535770	missense	unknown
R1678:Col4a4	UTSW	1	82486659	missense	unknown
R1827:Col4a4	UTSW	1	82539988	missense	unknown
R1930:Col4a4	UTSW	1	82466600	splice site	probably null
R1931:Col4a4	UTSW	1	82466600	splice site	probably null
R2092:Col4a4	UTSW	1	82498946	missense	unknown
R2122:Col4a4	UTSW	1	82456871	missense	unknown
R2132:Col4a4	UTSW	1	82497860	missense	unknown
R2396:Col4a4	UTSW	1	82507072	missense	unknown
R2418:Col4a4	UTSW	1	82532936	missense	unknown
R2679:Col4a4	UTSW	1	82529611	missense	unknown
R3085:Col4a4	UTSW	1	82529564	critical splice donor site	probably null
R3437:Col4a4	UTSW	1	82497168	missense	unknown
R3697:Col4a4	UTSW	1	82541237	missense	unknown
R3730:Col4a4	UTSW	1	82455751	splice site	probably null
R3752:Col4a4	UTSW	1	82480494	missense	probably damaging	0.97
R4085:Col4a4	UTSW	1	82471188	critical splice donor site	probably null
R4087:Col4a4	UTSW	1	82523922	missense	unknown
R4088:Col4a4	UTSW	1	82523922	missense	unknown
R4090:Col4a4	UTSW	1	82523922	missense	unknown
R4213:Col4a4	UTSW	1	82453144	missense	unknown
R4422:Col4a4	UTSW	1	82489838	missense	unknown
R4596:Col4a4	UTSW	1	82471219	missense	unknown
R4755:Col4a4	UTSW	1	82541174	missense	unknown
R4757:Col4a4	UTSW	1	82528466	missense	unknown
R4793:Col4a4	UTSW	1	82539099	missense	unknown
R4812:Col4a4	UTSW	1	82462153	missense	unknown
R4833:Col4a4	UTSW	1	82529602	missense	unknown
R5259:Col4a4	UTSW	1	82453893	missense	unknown
R5265:Col4a4	UTSW	1	82493591	missense	unknown
R5281:Col4a4	UTSW	1	82493591	missense	unknown
R5283:Col4a4	UTSW	1	82493591	missense	unknown
R5284:Col4a4	UTSW	1	82493591	missense	unknown
R5387:Col4a4	UTSW	1	82493591	missense	unknown
R5388:Col4a4	UTSW	1	82493591	missense	unknown
R5435:Col4a4	UTSW	1	82454007	missense	unknown
R5534:Col4a4	UTSW	1	82487517	missense	unknown
R5666:Col4a4	UTSW	1	82485579	critical splice donor site	probably null
R5670:Col4a4	UTSW	1	82485579	critical splice donor site	probably null
R5943:Col4a4	UTSW	1	82525016	missense	unknown
R5996:Col4a4	UTSW	1	82455728	missense	unknown
R5999:Col4a4	UTSW	1	82492619	missense	unknown
R6112:Col4a4	UTSW	1	82453883	missense	unknown
R6192:Col4a4	UTSW	1	82484430	missense	probably damaging	1.00
R6237:Col4a4	UTSW	1	82507031	missense	unknown
R6419:Col4a4	UTSW	1	82466486	critical splice donor site	probably null
R6458:Col4a4	UTSW	1	82455825	missense	unknown
R6460:Col4a4	UTSW	1	82466532	missense	unknown
R6481:Col4a4	UTSW	1	82453778	missense	unknown
R6522:Col4a4	UTSW	1	82487583	missense	unknown
R7000:Col4a4	UTSW	1	82497330	missense	unknown
R7015:Col4a4	UTSW	1	82506950	missense	unknown
R7055:Col4a4	UTSW	1	82519036	missense	unknown
R7288:Col4a4	UTSW	1	82492463	missense	unknown
R7293:Col4a4	UTSW	1	82523943	missense	unknown
R7300:Col4a4	UTSW	1	82486640	missense	unknown
R7458:Col4a4	UTSW	1	82498948	missense	unknown
R7520:Col4a4	UTSW	1	82507087	nonsense	probably null
R7727:Col4a4	UTSW	1	82528793	missense	unknown
R7803:Col4a4	UTSW	1	82489698	critical splice donor site	probably null
R7953:Col4a4	UTSW	1	82453968	missense	unknown
R7959:Col4a4	UTSW	1	82507059	missense	unknown
R7982:Col4a4	UTSW	1	82571441	start gained	probably benign
R8000:Col4a4	UTSW	1	82541297	missense	unknown
R8057:Col4a4	UTSW	1	82523870	missense	unknown
R8126:Col4a4	UTSW	1	82453286	missense	unknown
R8406:Col4a4	UTSW	1	82523890	missense	unknown
R8699:Col4a4	UTSW	1	82455734	missense	unknown
R8835:Col4a4	UTSW	1	82469592	missense	unknown
R8916:Col4a4	UTSW	1	82523946	missense	unknown
R8921:Col4a4	UTSW	1	82453812	missense	unknown
R8990:Col4a4	UTSW	1	82495834	missense	unknown
R9002:Col4a4	UTSW	1	82471311	missense	probably benign	0.26
R9116:Col4a4	UTSW	1	82454031	missense	unknown
R9176:Col4a4	UTSW	1	82485628	missense	unknown
R9211:Col4a4	UTSW	1	82528780	missense	unknown
R9246:Col4a4	UTSW	1	82453235	missense	unknown
R9463:Col4a4	UTSW	1	82453355	missense	unknown
R9666:Col4a4	UTSW	1	82518949	missense	unknown
R9686:Col4a4	UTSW	1	82497241	missense	unknown
R9705:Col4a4	UTSW	1	82487592	missense	unknown
R9749:Col4a4	UTSW	1	82485632	missense	unknown
R9774:Col4a4	UTSW	1	82506944	critical splice donor site	probably null
X0020:Col4a4	UTSW	1	82539952	critical splice donor site	probably null
Z1088:Col4a4	UTSW	1	82453196	missense	unknown

Predicted Primers

PCR Primer
(F):5'- GACCCTCTGTCTGTTTTCTTAAGAG -3'
(R):5'- CCACACTGGAAAACTTTTGGGG -3'

Sequencing Primer
(F):5'- CTCTGTCTGTTTTCTTAAGAGTATCC -3'
(R):5'- CCATGAAGGGATGCTGCTTAC -3'

Posted On

2016-07-06