Incidental Mutation 'R5264:Nectin4'
ID401581
Institutional Source Beutler Lab
Gene Symbol Nectin4
Ensembl Gene ENSMUSG00000006411
Gene Namenectin cell adhesion molecule 4
Synonyms1200017F15Rik, Prr4, Pvrl4, nectin 4
MMRRC Submission 042832-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.087) question?
Stock #R5264 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location171370099-171388598 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 171383705 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 266 (T266S)
Ref Sequence ENSEMBL: ENSMUSP00000106917 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006578] [ENSMUST00000094325] [ENSMUST00000111286]
Predicted Effect probably benign
Transcript: ENSMUST00000006578
AA Change: T266S

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000006578
Gene: ENSMUSG00000006411
AA Change: T266S

DomainStartEndE-ValueType
IG 36 145 9.26e-8 SMART
Pfam:Ig_2 147 241 4e-4 PFAM
Pfam:C2-set_2 150 233 9e-17 PFAM
IGc2 259 321 9.78e-7 SMART
transmembrane domain 348 370 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000094325
AA Change: T266S

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000091883
Gene: ENSMUSG00000006411
AA Change: T266S

DomainStartEndE-ValueType
IG 36 145 9.26e-8 SMART
Pfam:Ig_2 147 241 2.1e-4 PFAM
Pfam:C2-set_2 150 233 8.7e-17 PFAM
IGc2 259 321 9.78e-7 SMART
transmembrane domain 348 370 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111286
AA Change: T266S

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000106917
Gene: ENSMUSG00000006411
AA Change: T266S

DomainStartEndE-ValueType
IG 100 209 9.26e-8 SMART
Pfam:C2-set_2 214 297 1.2e-16 PFAM
IGc2 323 385 9.78e-7 SMART
transmembrane domain 412 434 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.8%
Validation Efficiency 98% (54/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the nectin family. The encoded protein contains two immunoglobulin-like (Ig-like) C2-type domains and one Ig-like V-type domain. It is involved in cell adhesion through trans-homophilic and -heterophilic interactions. It is a single-pass type I membrane protein. The soluble form is produced by proteolytic cleavage at the cell surface by the metalloproteinase ADAM17/TACE. The secreted form is found in both breast tumor cell lines and breast tumor patients. Mutations in this gene are the cause of ectodermal dysplasia-syndactyly syndrome type 1, an autosomal recessive disorder. Alternatively spliced transcript variants have been found but the full-length nature of the variant has not been determined.[provided by RefSeq, Jan 2011]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Casc1 A G 6: 145,181,776 V469A probably benign Het
Ckap2l A T 2: 129,285,379 M293K probably benign Het
Col4a4 C T 1: 82,493,591 G681E unknown Het
Efcab7 G A 4: 99,878,170 R132H probably benign Het
Elovl4 T C 9: 83,780,764 T239A probably benign Het
Fank1 A G 7: 133,879,892 D240G probably damaging Het
Fbln5 T A 12: 101,757,444 M346L possibly damaging Het
Fbxl21 T C 13: 56,532,323 F174L probably benign Het
Gns A G 10: 121,380,185 D279G probably benign Het
Hmcn1 A G 1: 150,679,514 V2502A probably benign Het
Itgb4 C T 11: 115,984,157 R447W probably benign Het
Large2 A G 2: 92,374,743 probably benign Het
Lrrc8b A T 5: 105,480,252 I155F probably damaging Het
Morc2b T C 17: 33,138,379 I140V probably benign Het
Mrgprb5 G A 7: 48,168,048 S313L probably benign Het
Nsd1 C T 13: 55,247,346 A1023V possibly damaging Het
Olfr33 T C 7: 102,714,351 T21A probably benign Het
Paqr8 A G 1: 20,935,108 H162R possibly damaging Het
Pclo G A 5: 14,676,923 probably benign Het
Phactr4 T C 4: 132,370,982 D325G probably damaging Het
Plcg2 A T 8: 117,634,793 E1255V possibly damaging Het
Polr3a T C 14: 24,454,941 I1084V possibly damaging Het
Polr3b A T 10: 84,667,416 Q399L probably benign Het
Ppp1r35 G A 5: 137,780,024 probably benign Het
Psd3 A T 8: 67,713,725 D919E probably benign Het
Ptgs2 A G 1: 150,102,730 T198A possibly damaging Het
Ptpn14 T C 1: 189,832,800 probably null Het
Ptprk A G 10: 28,585,586 Y39C probably damaging Het
R3hdm4 A G 10: 79,913,341 Y75H probably benign Het
Rsph4a A G 10: 33,909,383 Y430C probably damaging Het
Samd12 C T 15: 53,860,273 C8Y probably damaging Het
Sema3e A C 5: 14,226,648 L314F probably damaging Het
Sis A G 3: 72,949,756 F401L probably damaging Het
Smoc1 T A 12: 81,104,700 S64T probably damaging Het
Socs5 T A 17: 87,134,341 H236Q probably damaging Het
Spaca1 C A 4: 34,049,863 R45L possibly damaging Het
Spag6 A G 2: 18,745,513 K457E probably benign Het
Stat2 T A 10: 128,281,065 probably null Het
Tcp11l2 A G 10: 84,613,660 I496M probably damaging Het
Ttll4 A G 1: 74,686,376 I648V possibly damaging Het
Vmn2r67 T C 7: 85,152,245 Y161C probably damaging Het
Wnt5b A T 6: 119,433,852 V171E probably damaging Het
Zfp236 T C 18: 82,630,094 K933E probably damaging Het
Zfp236 T C 18: 82,658,073 E373G probably damaging Het
Zfp617 A G 8: 71,933,041 Y405C probably damaging Het
Zranb1 CTGATGATGATG CTGATGATGATGATG 7: 132,982,827 probably benign Het
Other mutations in Nectin4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00819:Nectin4 APN 1 171384686 missense probably damaging 1.00
IGL01558:Nectin4 APN 1 171384689 missense probably benign 0.00
IGL02608:Nectin4 APN 1 171384773 missense probably benign 0.05
R2047:Nectin4 UTSW 1 171385152 missense possibly damaging 0.61
R2203:Nectin4 UTSW 1 171386229 missense possibly damaging 0.78
R2518:Nectin4 UTSW 1 171380208 missense probably benign 0.00
R4125:Nectin4 UTSW 1 171385733 missense probably benign 0.02
R4708:Nectin4 UTSW 1 171385146 missense probably benign 0.02
R4856:Nectin4 UTSW 1 171384815 missense possibly damaging 0.46
R4886:Nectin4 UTSW 1 171384815 missense possibly damaging 0.46
R5222:Nectin4 UTSW 1 171385257 splice site probably null
R5661:Nectin4 UTSW 1 171385170 missense probably damaging 1.00
R6466:Nectin4 UTSW 1 171386753 missense probably damaging 1.00
R6714:Nectin4 UTSW 1 171370650 start gained probably benign
R7272:Nectin4 UTSW 1 171386644 missense probably damaging 1.00
R7302:Nectin4 UTSW 1 171386635 nonsense probably null
R7318:Nectin4 UTSW 1 171380463 missense probably benign 0.16
R7669:Nectin4 UTSW 1 171380259 missense probably benign 0.00
R7732:Nectin4 UTSW 1 171386678 missense probably benign 0.00
R7751:Nectin4 UTSW 1 171383758 critical splice donor site probably null
R7912:Nectin4 UTSW 1 171380373 missense possibly damaging 0.86
R7993:Nectin4 UTSW 1 171383754 missense probably damaging 1.00
R8029:Nectin4 UTSW 1 171386687 missense probably benign 0.04
R8306:Nectin4 UTSW 1 171383757 missense probably null 1.00
R8314:Nectin4 UTSW 1 171384727 missense probably benign 0.44
Predicted Primers PCR Primer
(F):5'- GTCAACCAAAATGGACTCTGAG -3'
(R):5'- GTCTGAATCTATGCCCCGAC -3'

Sequencing Primer
(F):5'- CCAAAATGGACTCTGAGCTTGG -3'
(R):5'- GAATCTATGCCCCGACTTAGCTAGG -3'
Posted On2016-07-06