Incidental Mutation 'R5264:Large2'
ID401585
Institutional Source Beutler Lab
Gene Symbol Large2
Ensembl Gene ENSMUSG00000040434
Gene NameLARGE xylosyl- and glucuronyltransferase 2
Synonyms5730485C17Rik, Gyltl1b
MMRRC Submission 042832-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5264 (G1)
Quality Score161
Status Validated
Chromosome2
Chromosomal Location92365046-92374869 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) A to G at 92374743 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000135024 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028650] [ENSMUST00000068586] [ENSMUST00000090582] [ENSMUST00000111284] [ENSMUST00000148352] [ENSMUST00000176774] [ENSMUST00000176339] [ENSMUST00000176289] [ENSMUST00000176810]
Predicted Effect probably benign
Transcript: ENSMUST00000028650
SMART Domains Protein: ENSMUSP00000028650
Gene: ENSMUSG00000027222

DomainStartEndE-ValueType
Pfam:Pex16 9 329 1.3e-91 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000068586
SMART Domains Protein: ENSMUSP00000064128
Gene: ENSMUSG00000040434

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
low complexity region 52 63 N/A INTRINSIC
Pfam:Glyco_transf_8 70 316 4.6e-22 PFAM
low complexity region 392 401 N/A INTRINSIC
Pfam:Glyco_transf_49 402 469 2.2e-11 PFAM
Pfam:Glyco_transf_49 466 673 1e-42 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000090582
SMART Domains Protein: ENSMUSP00000088070
Gene: ENSMUSG00000040434

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
low complexity region 52 63 N/A INTRINSIC
Pfam:Glyco_transf_8 70 218 7.2e-9 PFAM
Pfam:Glyco_transf_8 188 281 2.3e-8 PFAM
low complexity region 357 366 N/A INTRINSIC
Pfam:Glyco_transf_49 367 434 2.1e-11 PFAM
Pfam:Glyco_transf_49 431 638 9.3e-43 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111284
SMART Domains Protein: ENSMUSP00000106915
Gene: ENSMUSG00000040434

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
low complexity region 77 88 N/A INTRINSIC
Pfam:Glyco_transf_8 97 341 8.9e-22 PFAM
low complexity region 417 426 N/A INTRINSIC
Pfam:Glyco_transf_49 427 494 6.5e-11 PFAM
Pfam:Glyco_transf_49 491 698 3.1e-42 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124428
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130283
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146311
Predicted Effect probably benign
Transcript: ENSMUST00000148352
SMART Domains Protein: ENSMUSP00000135451
Gene: ENSMUSG00000040434

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
low complexity region 52 63 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148386
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154669
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155891
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175740
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176402
Predicted Effect probably benign
Transcript: ENSMUST00000176774
SMART Domains Protein: ENSMUSP00000135400
Gene: ENSMUSG00000040434

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
low complexity region 52 63 N/A INTRINSIC
Pfam:Glyco_transf_8 71 317 3.9e-22 PFAM
low complexity region 393 402 N/A INTRINSIC
Pfam:Glyco_transf_49 403 470 1.6e-11 PFAM
Pfam:Glyco_transf_49 467 674 7.4e-43 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000176339
SMART Domains Protein: ENSMUSP00000135619
Gene: ENSMUSG00000040434

DomainStartEndE-ValueType
transmembrane domain 31 50 N/A INTRINSIC
low complexity region 74 85 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000176289
SMART Domains Protein: ENSMUSP00000135118
Gene: ENSMUSG00000040434

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
low complexity region 52 63 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000176810
SMART Domains Protein: ENSMUSP00000135024
Gene: ENSMUSG00000040434

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
low complexity region 77 88 N/A INTRINSIC
Pfam:Glyco_transf_8 101 342 4.2e-20 PFAM
low complexity region 417 426 N/A INTRINSIC
Pfam:Glyco_transf_49 427 493 1.3e-13 PFAM
Pfam:Glyco_transf_49 489 698 2.8e-46 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.8%
Validation Efficiency 98% (54/55)
MGI Phenotype PHENOTYPE: Null mutant mice are healthy and are indistinguishable from control littermates with respect to body weight and life span when aged up to one year. No increased spontaneous tumor load was observed. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Casc1 A G 6: 145,181,776 V469A probably benign Het
Ckap2l A T 2: 129,285,379 M293K probably benign Het
Col4a4 C T 1: 82,493,591 G681E unknown Het
Efcab7 G A 4: 99,878,170 R132H probably benign Het
Elovl4 T C 9: 83,780,764 T239A probably benign Het
Fank1 A G 7: 133,879,892 D240G probably damaging Het
Fbln5 T A 12: 101,757,444 M346L possibly damaging Het
Fbxl21 T C 13: 56,532,323 F174L probably benign Het
Gns A G 10: 121,380,185 D279G probably benign Het
Hmcn1 A G 1: 150,679,514 V2502A probably benign Het
Itgb4 C T 11: 115,984,157 R447W probably benign Het
Lrrc8b A T 5: 105,480,252 I155F probably damaging Het
Morc2b T C 17: 33,138,379 I140V probably benign Het
Mrgprb5 G A 7: 48,168,048 S313L probably benign Het
Nectin4 A T 1: 171,383,705 T266S probably benign Het
Nsd1 C T 13: 55,247,346 A1023V possibly damaging Het
Olfr33 T C 7: 102,714,351 T21A probably benign Het
Paqr8 A G 1: 20,935,108 H162R possibly damaging Het
Pclo G A 5: 14,676,923 probably benign Het
Phactr4 T C 4: 132,370,982 D325G probably damaging Het
Plcg2 A T 8: 117,634,793 E1255V possibly damaging Het
Polr3a T C 14: 24,454,941 I1084V possibly damaging Het
Polr3b A T 10: 84,667,416 Q399L probably benign Het
Ppp1r35 G A 5: 137,780,024 probably benign Het
Psd3 A T 8: 67,713,725 D919E probably benign Het
Ptgs2 A G 1: 150,102,730 T198A possibly damaging Het
Ptpn14 T C 1: 189,832,800 probably null Het
Ptprk A G 10: 28,585,586 Y39C probably damaging Het
R3hdm4 A G 10: 79,913,341 Y75H probably benign Het
Rsph4a A G 10: 33,909,383 Y430C probably damaging Het
Samd12 C T 15: 53,860,273 C8Y probably damaging Het
Sema3e A C 5: 14,226,648 L314F probably damaging Het
Sis A G 3: 72,949,756 F401L probably damaging Het
Smoc1 T A 12: 81,104,700 S64T probably damaging Het
Socs5 T A 17: 87,134,341 H236Q probably damaging Het
Spaca1 C A 4: 34,049,863 R45L possibly damaging Het
Spag6 A G 2: 18,745,513 K457E probably benign Het
Stat2 T A 10: 128,281,065 probably null Het
Tcp11l2 A G 10: 84,613,660 I496M probably damaging Het
Ttll4 A G 1: 74,686,376 I648V possibly damaging Het
Vmn2r67 T C 7: 85,152,245 Y161C probably damaging Het
Wnt5b A T 6: 119,433,852 V171E probably damaging Het
Zfp236 T C 18: 82,630,094 K933E probably damaging Het
Zfp236 T C 18: 82,658,073 E373G probably damaging Het
Zfp617 A G 8: 71,933,041 Y405C probably damaging Het
Zranb1 CTGATGATGATG CTGATGATGATGATG 7: 132,982,827 probably benign Het
Other mutations in Large2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01143:Large2 APN 2 92366339 missense probably damaging 1.00
IGL01152:Large2 APN 2 92370639 missense probably damaging 1.00
IGL01377:Large2 APN 2 92369331 missense probably damaging 1.00
IGL01764:Large2 APN 2 92367186 splice site probably benign
IGL02016:Large2 APN 2 92369543 missense possibly damaging 0.82
IGL02396:Large2 APN 2 92366323 nonsense probably null
IGL02996:Large2 APN 2 92365928 missense possibly damaging 0.88
IGL03011:Large2 APN 2 92367582 missense probably damaging 1.00
egged UTSW 2 92370508 intron probably benign
P0041:Large2 UTSW 2 92367254 splice site probably benign
R1915:Large2 UTSW 2 92365825 splice site probably benign
R4193:Large2 UTSW 2 92365359 missense probably damaging 1.00
R4239:Large2 UTSW 2 92366605 splice site probably benign
R4580:Large2 UTSW 2 92370612 missense possibly damaging 0.66
R4679:Large2 UTSW 2 92367558 missense probably benign 0.31
R4857:Large2 UTSW 2 92366634 intron probably benign
R4918:Large2 UTSW 2 92366107 intron probably benign
R5050:Large2 UTSW 2 92367779 missense probably benign 0.05
R5237:Large2 UTSW 2 92367142 missense probably benign 0.16
R5508:Large2 UTSW 2 92369903 missense possibly damaging 0.80
R5999:Large2 UTSW 2 92366058 missense probably benign 0.01
R6077:Large2 UTSW 2 92366570 missense probably benign 0.00
R6167:Large2 UTSW 2 92367088 missense probably benign 0.44
R6218:Large2 UTSW 2 92370636 missense probably damaging 0.99
R6225:Large2 UTSW 2 92366480 missense probably damaging 1.00
R6301:Large2 UTSW 2 92369516 missense probably damaging 1.00
R6376:Large2 UTSW 2 92370508 intron probably benign
R6485:Large2 UTSW 2 92366028 missense probably benign
R6727:Large2 UTSW 2 92370870 utr 5 prime probably benign
R6942:Large2 UTSW 2 92370822 missense probably damaging 0.99
R7051:Large2 UTSW 2 92367022 missense probably damaging 0.97
R7318:Large2 UTSW 2 92366028 missense probably benign
R7581:Large2 UTSW 2 92370193 missense probably damaging 1.00
R7640:Large2 UTSW 2 92374705 start codon destroyed probably null
Z1176:Large2 UTSW 2 92370198 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AACGGCATATTCTGTCCTTGTC -3'
(R):5'- TCTGCTCTCCGTTTAGGGAC -3'

Sequencing Primer
(F):5'- ACGGCATATTCTGTCCTTGTCTAAAG -3'
(R):5'- ACGACCCTGCGCATTAGC -3'
Posted On2016-07-06