Mutagenetix > Incidental Mutation

Incidental Mutation 'R5264:Ckap2l'

401586

Institutional Source

Beutler Lab

Gene Symbol

Ckap2l

Ensembl Gene

ENSMUSG00000048327

Gene Name

cytoskeleton associated protein 2-like

Synonyms

MMRRC Submission

042832-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.447) question?

Stock #

R5264 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

129268210-129297212 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 129285379 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Lysine at position 293 (M293K)

Ref Sequence

ENSEMBL: ENSMUSP00000056145 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000052708]

AlphaFold

Q7TS74

Predicted Effect

probably benign
Transcript: ENSMUST00000052708
AA Change: M293K

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)

SMART Domains

Protein: ENSMUSP00000056145
Gene: ENSMUSG00000048327
AA Change: M293K

Domain	Start	End	E-Value	Type
low complexity region	45	58	N/A	INTRINSIC
Pfam:CKAP2_C	425	644	3e-32	PFAM
Pfam:CKAP2_C	675	734	6.9e-18	PFAM

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.0%
20x: 94.8%

Validation Efficiency

98% (54/55)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is thought to be a mitotic spindle protein important to neural stem or progenitor cells. Mutations in this gene have been associated with spindle organization defects, including mitotic spindle defects, lagging chromosomes, and chromatin bridges. There is evidence that mutations in this gene are associated with Filippi syndrome, characterized by growth defects, microcephaly, intellectual disability, facial feature defects, and syndactyly. There is a pseudogene of this gene on chromosome 20. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2015]

Allele List at MGI

Other mutations in this stock

Total: 46 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Casc1	A	G	6: 145,181,776	V469A	probably benign	Het
Col4a4	C	T	1: 82,493,591	G681E	unknown	Het
Efcab7	G	A	4: 99,878,170	R132H	probably benign	Het
Elovl4	T	C	9: 83,780,764	T239A	probably benign	Het
Fank1	A	G	7: 133,879,892	D240G	probably damaging	Het
Fbln5	T	A	12: 101,757,444	M346L	possibly damaging	Het
Fbxl21	T	C	13: 56,532,323	F174L	probably benign	Het
Gns	A	G	10: 121,380,185	D279G	probably benign	Het
Hmcn1	A	G	1: 150,679,514	V2502A	probably benign	Het
Itgb4	C	T	11: 115,984,157	R447W	probably benign	Het
Large2	A	G	2: 92,374,743		probably benign	Het
Lrrc8b	A	T	5: 105,480,252	I155F	probably damaging	Het
Morc2b	T	C	17: 33,138,379	I140V	probably benign	Het
Mrgprb5	G	A	7: 48,168,048	S313L	probably benign	Het
Nectin4	A	T	1: 171,383,705	T266S	probably benign	Het
Nsd1	C	T	13: 55,247,346	A1023V	possibly damaging	Het
Olfr33	T	C	7: 102,714,351	T21A	probably benign	Het
Paqr8	A	G	1: 20,935,108	H162R	possibly damaging	Het
Pclo	G	A	5: 14,676,923		probably benign	Het
Phactr4	T	C	4: 132,370,982	D325G	probably damaging	Het
Plcg2	A	T	8: 117,634,793	E1255V	possibly damaging	Het
Polr3a	T	C	14: 24,454,941	I1084V	possibly damaging	Het
Polr3b	A	T	10: 84,667,416	Q399L	probably benign	Het
Ppp1r35	G	A	5: 137,780,024		probably benign	Het
Psd3	A	T	8: 67,713,725	D919E	probably benign	Het
Ptgs2	A	G	1: 150,102,730	T198A	possibly damaging	Het
Ptpn14	T	C	1: 189,832,800		probably null	Het
Ptprk	A	G	10: 28,585,586	Y39C	probably damaging	Het
R3hdm4	A	G	10: 79,913,341	Y75H	probably benign	Het
Rsph4a	A	G	10: 33,909,383	Y430C	probably damaging	Het
Samd12	C	T	15: 53,860,273	C8Y	probably damaging	Het
Sema3e	A	C	5: 14,226,648	L314F	probably damaging	Het
Sis	A	G	3: 72,949,756	F401L	probably damaging	Het
Smoc1	T	A	12: 81,104,700	S64T	probably damaging	Het
Socs5	T	A	17: 87,134,341	H236Q	probably damaging	Het
Spaca1	C	A	4: 34,049,863	R45L	possibly damaging	Het
Spag6	A	G	2: 18,745,513	K457E	probably benign	Het
Stat2	T	A	10: 128,281,065		probably null	Het
Tcp11l2	A	G	10: 84,613,660	I496M	probably damaging	Het
Ttll4	A	G	1: 74,686,376	I648V	possibly damaging	Het
Vmn2r67	T	C	7: 85,152,245	Y161C	probably damaging	Het
Wnt5b	A	T	6: 119,433,852	V171E	probably damaging	Het
Zfp236	T	C	18: 82,630,094	K933E	probably damaging	Het
Zfp236	T	C	18: 82,658,073	E373G	probably damaging	Het
Zfp617	A	G	8: 71,933,041	Y405C	probably damaging	Het
Zranb1	CTGATGATGATG	CTGATGATGATGATG	7: 132,982,827		probably benign	Het

Other mutations in Ckap2l

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01401:Ckap2l	APN	2	129269216	missense	probably damaging	1.00
IGL02120:Ckap2l	APN	2	129285622	missense	possibly damaging	0.58
IGL03085:Ckap2l	APN	2	129285047	missense	probably benign	0.00
IGL03175:Ckap2l	APN	2	129285517	missense	probably benign	0.01
IGL03333:Ckap2l	APN	2	129296308	splice site	probably null
R0196:Ckap2l	UTSW	2	129285422	missense	probably benign	0.43
R0501:Ckap2l	UTSW	2	129285491	missense	possibly damaging	0.78
R0715:Ckap2l	UTSW	2	129285716	missense	probably benign	0.02
R0834:Ckap2l	UTSW	2	129296304	splice site	probably benign
R1119:Ckap2l	UTSW	2	129272572	splice site	probably benign
R1561:Ckap2l	UTSW	2	129270725	missense	probably benign	0.01
R1677:Ckap2l	UTSW	2	129285167	missense	possibly damaging	0.86
R1823:Ckap2l	UTSW	2	129275579	missense	probably damaging	1.00
R1971:Ckap2l	UTSW	2	129285422	missense	possibly damaging	0.92
R4803:Ckap2l	UTSW	2	129269256	missense	probably damaging	1.00
R5214:Ckap2l	UTSW	2	129285469	missense	probably benign	0.02
R5297:Ckap2l	UTSW	2	129285370	missense	possibly damaging	0.56
R5535:Ckap2l	UTSW	2	129285842	missense	probably benign	0.00
R5606:Ckap2l	UTSW	2	129286039	missense	probably damaging	0.98
R6327:Ckap2l	UTSW	2	129285494	missense	probably damaging	1.00
R6489:Ckap2l	UTSW	2	129269114	missense	possibly damaging	0.85
R6726:Ckap2l	UTSW	2	129269194	missense	probably damaging	1.00
R7199:Ckap2l	UTSW	2	129285055	missense	probably benign	0.25
R7220:Ckap2l	UTSW	2	129275516	missense	probably damaging	1.00
R7329:Ckap2l	UTSW	2	129285364	missense	possibly damaging	0.56
R7374:Ckap2l	UTSW	2	129284963	missense	probably damaging	1.00
R7383:Ckap2l	UTSW	2	129269252	missense	possibly damaging	0.88
R7484:Ckap2l	UTSW	2	129272535	missense	possibly damaging	0.82
R7611:Ckap2l	UTSW	2	129285680	missense	possibly damaging	0.88
R7868:Ckap2l	UTSW	2	129285289	missense	probably damaging	1.00
R8338:Ckap2l	UTSW	2	129285019	missense	probably damaging	0.99
R8514:Ckap2l	UTSW	2	129285868	missense	possibly damaging	0.61
R8790:Ckap2l	UTSW	2	129269252	missense	possibly damaging	0.88
R9043:Ckap2l	UTSW	2	129284972	missense	probably damaging	0.99
R9215:Ckap2l	UTSW	2	129281906	missense	possibly damaging	0.74
R9496:Ckap2l	UTSW	2	129270675	missense	probably benign	0.37
R9526:Ckap2l	UTSW	2	129269241	nonsense	probably null
RF037:Ckap2l	UTSW	2	129270649	small deletion	probably benign
Z1176:Ckap2l	UTSW	2	129285362	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CCAAGATGAGGCTGTACAGG -3'
(R):5'- AAGTTCAGTTACTCAGACTGCTC -3'

Sequencing Primer
(F):5'- GCTGTACAGGCTTCTGATCC -3'
(R):5'- GCTCTGAAAGACAGAGCT -3'

Posted On

2016-07-06