Incidental Mutation 'R5264:Lrrc8b'
ID401594
Institutional Source Beutler Lab
Gene Symbol Lrrc8b
Ensembl Gene ENSMUSG00000070639
Gene Nameleucine rich repeat containing 8 family, member B
SynonymsR75581
MMRRC Submission 042832-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.206) question?
Stock #R5264 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location105415775-105490074 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 105480252 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 155 (I155F)
Ref Sequence ENSEMBL: ENSMUSP00000108327 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000112707]
Predicted Effect probably damaging
Transcript: ENSMUST00000112707
AA Change: I155F

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000108327
Gene: ENSMUSG00000070639
AA Change: I155F

DomainStartEndE-ValueType
Pfam:Pannexin_like 1 334 2.9e-133 PFAM
LRR 509 536 5.27e1 SMART
LRR 584 607 2.03e1 SMART
LRR 632 654 1.97e1 SMART
LRR_TYP 655 678 4.79e-3 SMART
LRR 679 700 3.09e1 SMART
LRR_TYP 701 724 4.17e-3 SMART
LRR 747 770 2.17e-1 SMART
Meta Mutation Damage Score 0.2 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.8%
Validation Efficiency 98% (54/55)
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Casc1 A G 6: 145,181,776 V469A probably benign Het
Ckap2l A T 2: 129,285,379 M293K probably benign Het
Col4a4 C T 1: 82,493,591 G681E unknown Het
Efcab7 G A 4: 99,878,170 R132H probably benign Het
Elovl4 T C 9: 83,780,764 T239A probably benign Het
Fank1 A G 7: 133,879,892 D240G probably damaging Het
Fbln5 T A 12: 101,757,444 M346L possibly damaging Het
Fbxl21 T C 13: 56,532,323 F174L probably benign Het
Gns A G 10: 121,380,185 D279G probably benign Het
Hmcn1 A G 1: 150,679,514 V2502A probably benign Het
Itgb4 C T 11: 115,984,157 R447W probably benign Het
Large2 A G 2: 92,374,743 probably benign Het
Morc2b T C 17: 33,138,379 I140V probably benign Het
Mrgprb5 G A 7: 48,168,048 S313L probably benign Het
Nectin4 A T 1: 171,383,705 T266S probably benign Het
Nsd1 C T 13: 55,247,346 A1023V possibly damaging Het
Olfr33 T C 7: 102,714,351 T21A probably benign Het
Paqr8 A G 1: 20,935,108 H162R possibly damaging Het
Pclo G A 5: 14,676,923 probably benign Het
Phactr4 T C 4: 132,370,982 D325G probably damaging Het
Plcg2 A T 8: 117,634,793 E1255V possibly damaging Het
Polr3a T C 14: 24,454,941 I1084V possibly damaging Het
Polr3b A T 10: 84,667,416 Q399L probably benign Het
Ppp1r35 G A 5: 137,780,024 probably benign Het
Psd3 A T 8: 67,713,725 D919E probably benign Het
Ptgs2 A G 1: 150,102,730 T198A possibly damaging Het
Ptpn14 T C 1: 189,832,800 probably null Het
Ptprk A G 10: 28,585,586 Y39C probably damaging Het
R3hdm4 A G 10: 79,913,341 Y75H probably benign Het
Rsph4a A G 10: 33,909,383 Y430C probably damaging Het
Samd12 C T 15: 53,860,273 C8Y probably damaging Het
Sema3e A C 5: 14,226,648 L314F probably damaging Het
Sis A G 3: 72,949,756 F401L probably damaging Het
Smoc1 T A 12: 81,104,700 S64T probably damaging Het
Socs5 T A 17: 87,134,341 H236Q probably damaging Het
Spaca1 C A 4: 34,049,863 R45L possibly damaging Het
Spag6 A G 2: 18,745,513 K457E probably benign Het
Stat2 T A 10: 128,281,065 probably null Het
Tcp11l2 A G 10: 84,613,660 I496M probably damaging Het
Ttll4 A G 1: 74,686,376 I648V possibly damaging Het
Vmn2r67 T C 7: 85,152,245 Y161C probably damaging Het
Wnt5b A T 6: 119,433,852 V171E probably damaging Het
Zfp236 T C 18: 82,630,094 K933E probably damaging Het
Zfp236 T C 18: 82,658,073 E373G probably damaging Het
Zfp617 A G 8: 71,933,041 Y405C probably damaging Het
Zranb1 CTGATGATGATG CTGATGATGATGATG 7: 132,982,827 probably benign Het
Other mutations in Lrrc8b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00335:Lrrc8b APN 5 105480499 missense probably damaging 0.96
IGL00519:Lrrc8b APN 5 105481725 missense possibly damaging 0.82
IGL01732:Lrrc8b APN 5 105485960 missense probably damaging 1.00
IGL01799:Lrrc8b APN 5 105485891 missense probably benign
IGL02005:Lrrc8b APN 5 105481054 missense probably benign 0.22
IGL02205:Lrrc8b APN 5 105481837 missense probably benign 0.07
IGL03038:Lrrc8b APN 5 105481492 missense probably damaging 0.98
IGL03076:Lrrc8b APN 5 105481549 missense probably damaging 1.00
IGL02796:Lrrc8b UTSW 5 105481345 missense probably damaging 1.00
R0647:Lrrc8b UTSW 5 105480607 missense possibly damaging 0.69
R0722:Lrrc8b UTSW 5 105480112 missense possibly damaging 0.89
R1382:Lrrc8b UTSW 5 105480883 missense probably damaging 1.00
R1437:Lrrc8b UTSW 5 105481702 missense probably damaging 1.00
R1801:Lrrc8b UTSW 5 105480823 missense probably damaging 1.00
R1888:Lrrc8b UTSW 5 105481351 missense probably benign 0.12
R1888:Lrrc8b UTSW 5 105481351 missense probably benign 0.12
R2169:Lrrc8b UTSW 5 105481887 missense probably damaging 0.99
R4514:Lrrc8b UTSW 5 105479953 missense probably damaging 1.00
R4898:Lrrc8b UTSW 5 105480214 missense probably benign 0.19
R5243:Lrrc8b UTSW 5 105480946 missense probably damaging 1.00
R5424:Lrrc8b UTSW 5 105480703 missense probably damaging 1.00
R5513:Lrrc8b UTSW 5 105485984 missense probably damaging 1.00
R5632:Lrrc8b UTSW 5 105480297 missense possibly damaging 0.81
R5799:Lrrc8b UTSW 5 105481342 missense probably benign 0.19
R5800:Lrrc8b UTSW 5 105481342 missense probably benign 0.19
R6637:Lrrc8b UTSW 5 105480271 missense possibly damaging 0.80
R7249:Lrrc8b UTSW 5 105481267 missense probably benign 0.23
R7253:Lrrc8b UTSW 5 105481656 missense probably benign 0.01
R7558:Lrrc8b UTSW 5 105481711 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGCAGCAGTACTCCTACATC -3'
(R):5'- CAAAGATGGCCTTGGCTTG -3'

Sequencing Primer
(F):5'- TCGATGCTGTCTGCTACGAGAAAC -3'
(R):5'- CTTCTTGTCCAGGACGCTAGAAG -3'
Posted On2016-07-06