Incidental Mutation 'R5264:Mrgprb5'
ID401598
Institutional Source Beutler Lab
Gene Symbol Mrgprb5
Ensembl Gene ENSMUSG00000070551
Gene NameMAS-related GPR, member B5
SynonymsMrgB5
MMRRC Submission 042832-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.055) question?
Stock #R5264 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location48167983-48169019 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 48168048 bp
ZygosityHeterozygous
Amino Acid Change Serine to Leucine at position 313 (S313L)
Ref Sequence ENSEMBL: ENSMUSP00000091953 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094389]
Predicted Effect probably benign
Transcript: ENSMUST00000094389
AA Change: S313L

PolyPhen 2 Score 0.098 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000091953
Gene: ENSMUSG00000070551
AA Change: S313L

DomainStartEndE-ValueType
low complexity region 9 21 N/A INTRINSIC
Pfam:7TM_GPCR_Srx 38 217 1.4e-8 PFAM
Pfam:7tm_1 47 210 1.7e-7 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.8%
Validation Efficiency 98% (54/55)
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Casc1 A G 6: 145,181,776 V469A probably benign Het
Ckap2l A T 2: 129,285,379 M293K probably benign Het
Col4a4 C T 1: 82,493,591 G681E unknown Het
Efcab7 G A 4: 99,878,170 R132H probably benign Het
Elovl4 T C 9: 83,780,764 T239A probably benign Het
Fank1 A G 7: 133,879,892 D240G probably damaging Het
Fbln5 T A 12: 101,757,444 M346L possibly damaging Het
Fbxl21 T C 13: 56,532,323 F174L probably benign Het
Gns A G 10: 121,380,185 D279G probably benign Het
Hmcn1 A G 1: 150,679,514 V2502A probably benign Het
Itgb4 C T 11: 115,984,157 R447W probably benign Het
Large2 A G 2: 92,374,743 probably benign Het
Lrrc8b A T 5: 105,480,252 I155F probably damaging Het
Morc2b T C 17: 33,138,379 I140V probably benign Het
Nectin4 A T 1: 171,383,705 T266S probably benign Het
Nsd1 C T 13: 55,247,346 A1023V possibly damaging Het
Olfr33 T C 7: 102,714,351 T21A probably benign Het
Paqr8 A G 1: 20,935,108 H162R possibly damaging Het
Pclo G A 5: 14,676,923 probably benign Het
Phactr4 T C 4: 132,370,982 D325G probably damaging Het
Plcg2 A T 8: 117,634,793 E1255V possibly damaging Het
Polr3a T C 14: 24,454,941 I1084V possibly damaging Het
Polr3b A T 10: 84,667,416 Q399L probably benign Het
Ppp1r35 G A 5: 137,780,024 probably benign Het
Psd3 A T 8: 67,713,725 D919E probably benign Het
Ptgs2 A G 1: 150,102,730 T198A possibly damaging Het
Ptpn14 T C 1: 189,832,800 probably null Het
Ptprk A G 10: 28,585,586 Y39C probably damaging Het
R3hdm4 A G 10: 79,913,341 Y75H probably benign Het
Rsph4a A G 10: 33,909,383 Y430C probably damaging Het
Samd12 C T 15: 53,860,273 C8Y probably damaging Het
Sema3e A C 5: 14,226,648 L314F probably damaging Het
Sis A G 3: 72,949,756 F401L probably damaging Het
Smoc1 T A 12: 81,104,700 S64T probably damaging Het
Socs5 T A 17: 87,134,341 H236Q probably damaging Het
Spaca1 C A 4: 34,049,863 R45L possibly damaging Het
Spag6 A G 2: 18,745,513 K457E probably benign Het
Stat2 T A 10: 128,281,065 probably null Het
Tcp11l2 A G 10: 84,613,660 I496M probably damaging Het
Ttll4 A G 1: 74,686,376 I648V possibly damaging Het
Vmn2r67 T C 7: 85,152,245 Y161C probably damaging Het
Wnt5b A T 6: 119,433,852 V171E probably damaging Het
Zfp236 T C 18: 82,630,094 K933E probably damaging Het
Zfp236 T C 18: 82,658,073 E373G probably damaging Het
Zfp617 A G 8: 71,933,041 Y405C probably damaging Het
Zranb1 CTGATGATGATG CTGATGATGATGATG 7: 132,982,827 probably benign Het
Other mutations in Mrgprb5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01516:Mrgprb5 APN 7 48168384 missense probably damaging 1.00
IGL01662:Mrgprb5 APN 7 48168424 missense probably benign 0.02
IGL01752:Mrgprb5 APN 7 48168667 missense probably benign 0.22
IGL02117:Mrgprb5 APN 7 48168994 utr 5 prime probably benign
IGL02866:Mrgprb5 APN 7 48168166 missense probably damaging 0.99
IGL03382:Mrgprb5 APN 7 48168694 missense probably benign 0.01
R0545:Mrgprb5 UTSW 7 48168885 missense probably benign 0.08
R1389:Mrgprb5 UTSW 7 48168330 missense probably damaging 1.00
R1939:Mrgprb5 UTSW 7 48168938 missense probably benign 0.00
R2277:Mrgprb5 UTSW 7 48168831 missense probably damaging 1.00
R2367:Mrgprb5 UTSW 7 48168599 nonsense probably null
R2912:Mrgprb5 UTSW 7 48168067 missense probably benign
R2968:Mrgprb5 UTSW 7 48168569 missense probably damaging 0.98
R2969:Mrgprb5 UTSW 7 48168569 missense probably damaging 0.98
R2970:Mrgprb5 UTSW 7 48168569 missense probably damaging 0.98
R3499:Mrgprb5 UTSW 7 48168913 missense probably benign 0.04
R3828:Mrgprb5 UTSW 7 48168091 missense probably benign 0.01
R4590:Mrgprb5 UTSW 7 48168061 missense probably benign 0.16
R4719:Mrgprb5 UTSW 7 48168778 missense probably damaging 1.00
R5263:Mrgprb5 UTSW 7 48168189 missense probably damaging 0.99
R5644:Mrgprb5 UTSW 7 48168207 missense probably benign 0.00
R6485:Mrgprb5 UTSW 7 48168777 missense probably damaging 0.99
R6713:Mrgprb5 UTSW 7 48168789 missense probably damaging 0.98
R7112:Mrgprb5 UTSW 7 48168907 missense probably benign
R7176:Mrgprb5 UTSW 7 48168311 missense possibly damaging 0.68
R7446:Mrgprb5 UTSW 7 48168504 missense possibly damaging 0.65
R7640:Mrgprb5 UTSW 7 48168259 missense probably benign 0.00
R7831:Mrgprb5 UTSW 7 48168249 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- TCAGTTTCTGTGTAACAAGCCCC -3'
(R):5'- TTGCTCTCACATTGGTGGTC -3'

Sequencing Primer
(F):5'- GTGTAACAAGCCCCTTTCTCC -3'
(R):5'- TCTTACCATGTCCTTGAAGTGAC -3'
Posted On2016-07-06