Incidental Mutation 'R5264:Fank1'
ID401602
Institutional Source Beutler Lab
Gene Symbol Fank1
Ensembl Gene ENSMUSG00000053111
Gene Namefibronectin type 3 and ankyrin repeat domains 1
Synonyms
MMRRC Submission 042832-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.220) question?
Stock #R5264 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location133776861-133881532 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 133879892 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 240 (D240G)
Ref Sequence ENSEMBL: ENSMUSP00000069013 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065359] [ENSMUST00000067680] [ENSMUST00000121560] [ENSMUST00000151031] [ENSMUST00000209511]
PDB Structure
Solution structure of fibronectin type III domain of mouse hypothetical protein [SOLUTION NMR]
Predicted Effect probably damaging
Transcript: ENSMUST00000065359
AA Change: D240G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000069013
Gene: ENSMUSG00000053111
AA Change: D240G

DomainStartEndE-ValueType
FN3 9 94 4.74e-3 SMART
Blast:ANK 109 139 1e-9 BLAST
ANK 143 172 1.4e-4 SMART
ANK 176 205 3.18e-3 SMART
ANK 209 238 1.48e-3 SMART
ANK 243 273 2.5e-1 SMART
ANK 277 306 3.33e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000067680
SMART Domains Protein: ENSMUSP00000065213
Gene: ENSMUSG00000054555

DomainStartEndE-ValueType
signal peptide 1 31 N/A INTRINSIC
Pfam:Pep_M12B_propep 35 165 1.1e-27 PFAM
Pfam:Reprolysin_5 210 392 2.1e-24 PFAM
Pfam:Reprolysin_4 210 408 3.8e-16 PFAM
Pfam:Reprolysin 212 414 1.4e-74 PFAM
Pfam:Reprolysin_2 232 404 6e-18 PFAM
Pfam:Reprolysin_3 236 359 1.3e-16 PFAM
DISIN 431 506 4.29e-42 SMART
ACR 507 650 1.75e-67 SMART
transmembrane domain 705 727 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000121560
SMART Domains Protein: ENSMUSP00000114136
Gene: ENSMUSG00000053111

DomainStartEndE-ValueType
PDB:1WFU|A 1 66 3e-43 PDB
Blast:FN3 9 66 3e-35 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000151031
SMART Domains Protein: ENSMUSP00000119929
Gene: ENSMUSG00000053111

DomainStartEndE-ValueType
Blast:FN3 1 39 6e-20 BLAST
PDB:1WFU|A 1 52 3e-30 PDB
Blast:ANK 54 84 2e-10 BLAST
ANK 88 117 1.4e-4 SMART
ANK 121 150 3.18e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000209511
AA Change: D239G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Meta Mutation Damage Score 0.4606 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.8%
Validation Efficiency 98% (54/55)
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Casc1 A G 6: 145,181,776 V469A probably benign Het
Ckap2l A T 2: 129,285,379 M293K probably benign Het
Col4a4 C T 1: 82,493,591 G681E unknown Het
Efcab7 G A 4: 99,878,170 R132H probably benign Het
Elovl4 T C 9: 83,780,764 T239A probably benign Het
Fbln5 T A 12: 101,757,444 M346L possibly damaging Het
Fbxl21 T C 13: 56,532,323 F174L probably benign Het
Gns A G 10: 121,380,185 D279G probably benign Het
Hmcn1 A G 1: 150,679,514 V2502A probably benign Het
Itgb4 C T 11: 115,984,157 R447W probably benign Het
Large2 A G 2: 92,374,743 probably benign Het
Lrrc8b A T 5: 105,480,252 I155F probably damaging Het
Morc2b T C 17: 33,138,379 I140V probably benign Het
Mrgprb5 G A 7: 48,168,048 S313L probably benign Het
Nectin4 A T 1: 171,383,705 T266S probably benign Het
Nsd1 C T 13: 55,247,346 A1023V possibly damaging Het
Olfr33 T C 7: 102,714,351 T21A probably benign Het
Paqr8 A G 1: 20,935,108 H162R possibly damaging Het
Pclo G A 5: 14,676,923 probably benign Het
Phactr4 T C 4: 132,370,982 D325G probably damaging Het
Plcg2 A T 8: 117,634,793 E1255V possibly damaging Het
Polr3a T C 14: 24,454,941 I1084V possibly damaging Het
Polr3b A T 10: 84,667,416 Q399L probably benign Het
Ppp1r35 G A 5: 137,780,024 probably benign Het
Psd3 A T 8: 67,713,725 D919E probably benign Het
Ptgs2 A G 1: 150,102,730 T198A possibly damaging Het
Ptpn14 T C 1: 189,832,800 probably null Het
Ptprk A G 10: 28,585,586 Y39C probably damaging Het
R3hdm4 A G 10: 79,913,341 Y75H probably benign Het
Rsph4a A G 10: 33,909,383 Y430C probably damaging Het
Samd12 C T 15: 53,860,273 C8Y probably damaging Het
Sema3e A C 5: 14,226,648 L314F probably damaging Het
Sis A G 3: 72,949,756 F401L probably damaging Het
Smoc1 T A 12: 81,104,700 S64T probably damaging Het
Socs5 T A 17: 87,134,341 H236Q probably damaging Het
Spaca1 C A 4: 34,049,863 R45L possibly damaging Het
Spag6 A G 2: 18,745,513 K457E probably benign Het
Stat2 T A 10: 128,281,065 probably null Het
Tcp11l2 A G 10: 84,613,660 I496M probably damaging Het
Ttll4 A G 1: 74,686,376 I648V possibly damaging Het
Vmn2r67 T C 7: 85,152,245 Y161C probably damaging Het
Wnt5b A T 6: 119,433,852 V171E probably damaging Het
Zfp236 T C 18: 82,630,094 K933E probably damaging Het
Zfp236 T C 18: 82,658,073 E373G probably damaging Het
Zfp617 A G 8: 71,933,041 Y405C probably damaging Het
Zranb1 CTGATGATGATG CTGATGATGATGATG 7: 132,982,827 probably benign Het
Other mutations in Fank1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01487:Fank1 APN 7 133879909 missense probably damaging 1.00
IGL02646:Fank1 APN 7 133880029 splice site probably benign
IGL02973:Fank1 APN 7 133876849 missense probably damaging 1.00
IGL03309:Fank1 APN 7 133862173 missense probably damaging 0.97
PIT1430001:Fank1 UTSW 7 133876800 nonsense probably null
R0620:Fank1 UTSW 7 133876765 missense probably damaging 1.00
R0863:Fank1 UTSW 7 133880623 missense possibly damaging 0.66
R1997:Fank1 UTSW 7 133862225 missense probably damaging 0.96
R5103:Fank1 UTSW 7 133876841 nonsense probably null
R5353:Fank1 UTSW 7 133876903 missense probably damaging 0.99
R5523:Fank1 UTSW 7 133876840 missense probably damaging 1.00
R5579:Fank1 UTSW 7 133869329 splice site probably null
R5695:Fank1 UTSW 7 133869346 missense probably damaging 1.00
R6226:Fank1 UTSW 7 133862198 missense probably benign 0.05
R6996:Fank1 UTSW 7 133876898 missense possibly damaging 0.95
R7225:Fank1 UTSW 7 133853259 missense probably benign
R7884:Fank1 UTSW 7 133876825 missense probably damaging 1.00
R8086:Fank1 UTSW 7 133853230 missense possibly damaging 0.85
R8282:Fank1 UTSW 7 133876764 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TAGCAGATGAGTATGGCAGC -3'
(R):5'- TGCTCAATTCTCAAGCCACG -3'

Sequencing Primer
(F):5'- TCCTAGGTGACTCAGCAATCC -3'
(R):5'- GCTCAATTCTCAAGCCACGTGTAG -3'
Posted On2016-07-06