Incidental Mutation 'R5264:Gns'
ID401613
Institutional Source Beutler Lab
Gene Symbol Gns
Ensembl Gene ENSMUSG00000034707
Gene Nameglucosamine (N-acetyl)-6-sulfatase
SynonymsG6S, 2610016K11Rik
MMRRC Submission 042832-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.342) question?
Stock #R5264 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location121365090-121397249 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 121380185 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 279 (D279G)
Ref Sequence ENSEMBL: ENSMUSP00000043167 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040344] [ENSMUST00000219249] [ENSMUST00000219505] [ENSMUST00000219851]
Predicted Effect probably benign
Transcript: ENSMUST00000040344
AA Change: D279G

PolyPhen 2 Score 0.122 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000043167
Gene: ENSMUSG00000034707
AA Change: D279G

DomainStartEndE-ValueType
signal peptide 1 35 N/A INTRINSIC
Pfam:Sulfatase 39 376 1.4e-72 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217712
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219216
Predicted Effect probably benign
Transcript: ENSMUST00000219249
Predicted Effect probably benign
Transcript: ENSMUST00000219505
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219531
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219580
Predicted Effect probably benign
Transcript: ENSMUST00000219851
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220350
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.8%
Validation Efficiency 98% (54/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene is a lysosomal enzyme found in all cells. It is involved in the catabolism of heparin, heparan sulphate, and keratan sulphate. Deficiency of this enzyme results in the accumulation of undegraded substrate and the lysosomal storage disorder mucopolysaccharidosis type IIID (Sanfilippo D syndrome). Mucopolysaccharidosis type IIID is the least common of the four subtypes of Sanfilippo syndrome. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous KO results in progressive lysosomal glycosaminoglycan accumulation in the central nervous system and peripheral organs and causes hypoactivity and shortened lifespan. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Casc1 A G 6: 145,181,776 V469A probably benign Het
Ckap2l A T 2: 129,285,379 M293K probably benign Het
Col4a4 C T 1: 82,493,591 G681E unknown Het
Efcab7 G A 4: 99,878,170 R132H probably benign Het
Elovl4 T C 9: 83,780,764 T239A probably benign Het
Fank1 A G 7: 133,879,892 D240G probably damaging Het
Fbln5 T A 12: 101,757,444 M346L possibly damaging Het
Fbxl21 T C 13: 56,532,323 F174L probably benign Het
Hmcn1 A G 1: 150,679,514 V2502A probably benign Het
Itgb4 C T 11: 115,984,157 R447W probably benign Het
Large2 A G 2: 92,374,743 probably benign Het
Lrrc8b A T 5: 105,480,252 I155F probably damaging Het
Morc2b T C 17: 33,138,379 I140V probably benign Het
Mrgprb5 G A 7: 48,168,048 S313L probably benign Het
Nectin4 A T 1: 171,383,705 T266S probably benign Het
Nsd1 C T 13: 55,247,346 A1023V possibly damaging Het
Olfr33 T C 7: 102,714,351 T21A probably benign Het
Paqr8 A G 1: 20,935,108 H162R possibly damaging Het
Pclo G A 5: 14,676,923 probably benign Het
Phactr4 T C 4: 132,370,982 D325G probably damaging Het
Plcg2 A T 8: 117,634,793 E1255V possibly damaging Het
Polr3a T C 14: 24,454,941 I1084V possibly damaging Het
Polr3b A T 10: 84,667,416 Q399L probably benign Het
Ppp1r35 G A 5: 137,780,024 probably benign Het
Psd3 A T 8: 67,713,725 D919E probably benign Het
Ptgs2 A G 1: 150,102,730 T198A possibly damaging Het
Ptpn14 T C 1: 189,832,800 probably null Het
Ptprk A G 10: 28,585,586 Y39C probably damaging Het
R3hdm4 A G 10: 79,913,341 Y75H probably benign Het
Rsph4a A G 10: 33,909,383 Y430C probably damaging Het
Samd12 C T 15: 53,860,273 C8Y probably damaging Het
Sema3e A C 5: 14,226,648 L314F probably damaging Het
Sis A G 3: 72,949,756 F401L probably damaging Het
Smoc1 T A 12: 81,104,700 S64T probably damaging Het
Socs5 T A 17: 87,134,341 H236Q probably damaging Het
Spaca1 C A 4: 34,049,863 R45L possibly damaging Het
Spag6 A G 2: 18,745,513 K457E probably benign Het
Stat2 T A 10: 128,281,065 probably null Het
Tcp11l2 A G 10: 84,613,660 I496M probably damaging Het
Ttll4 A G 1: 74,686,376 I648V possibly damaging Het
Vmn2r67 T C 7: 85,152,245 Y161C probably damaging Het
Wnt5b A T 6: 119,433,852 V171E probably damaging Het
Zfp236 T C 18: 82,630,094 K933E probably damaging Het
Zfp236 T C 18: 82,658,073 E373G probably damaging Het
Zfp617 A G 8: 71,933,041 Y405C probably damaging Het
Zranb1 CTGATGATGATG CTGATGATGATGATG 7: 132,982,827 probably benign Het
Other mutations in Gns
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02097:Gns APN 10 121390693 missense probably benign 0.01
PIT4402001:Gns UTSW 10 121376706 missense probably damaging 1.00
R0086:Gns UTSW 10 121391473 missense probably damaging 1.00
R0344:Gns UTSW 10 121383423 missense probably benign 0.04
R0544:Gns UTSW 10 121376267 nonsense probably null
R0626:Gns UTSW 10 121383444 critical splice donor site probably null
R1770:Gns UTSW 10 121378047 missense probably benign 0.00
R2142:Gns UTSW 10 121392778 missense probably damaging 1.00
R4036:Gns UTSW 10 121371190 missense probably damaging 1.00
R4451:Gns UTSW 10 121376696 missense probably damaging 1.00
R4569:Gns UTSW 10 121381178 missense probably benign 0.00
R5467:Gns UTSW 10 121391446 missense probably benign 0.00
R7268:Gns UTSW 10 121376652 missense probably damaging 1.00
R7588:Gns UTSW 10 121390658 missense probably benign 0.18
R8083:Gns UTSW 10 121378103 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- GGCAACCTGACCTAGTCTTAAC -3'
(R):5'- AACATGGATGGTTTAGTCAGGC -3'

Sequencing Primer
(F):5'- GACCTAGTCTTAACATGGCTTCAAC -3'
(R):5'- CTTGGGGTCCAAAGGTACCTCATG -3'
Posted On2016-07-06