Incidental Mutation 'R5264:Stat2'
ID401614
Institutional Source Beutler Lab
Gene Symbol Stat2
Ensembl Gene ENSMUSG00000040033
Gene Namesignal transducer and activator of transcription 2
Synonyms1600010G07Rik
MMRRC Submission 042832-MU
Accession Numbers

Genbank: NM_019963.1; Ensembl: ENSMUST00000085708

Is this an essential gene? Possibly non essential (E-score: 0.256) question?
Stock #R5264 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location128270559-128292849 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to A at 128281065 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000100872 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085708] [ENSMUST00000105238]
Predicted Effect probably null
Transcript: ENSMUST00000085708
SMART Domains Protein: ENSMUSP00000082855
Gene: ENSMUSG00000040033

DomainStartEndE-ValueType
STAT_int 2 124 4.49e-54 SMART
Pfam:STAT_alpha 138 314 5e-52 PFAM
Pfam:STAT_bind 316 564 1.2e-96 PFAM
SH2 576 652 4.71e-6 SMART
internal_repeat_1 750 778 6.35e-10 PROSPERO
internal_repeat_1 822 850 6.35e-10 PROSPERO
Pfam:STAT2_C 853 907 1.1e-28 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000105238
SMART Domains Protein: ENSMUSP00000100872
Gene: ENSMUSG00000040033

DomainStartEndE-ValueType
STAT_int 2 124 4.49e-54 SMART
Pfam:STAT_alpha 141 314 2.6e-49 PFAM
Pfam:STAT_bind 316 564 1.5e-67 PFAM
SH2 577 653 4.71e-6 SMART
internal_repeat_1 751 779 6.69e-10 PROSPERO
internal_repeat_1 823 851 6.69e-10 PROSPERO
Pfam:STAT2_C 854 908 1.7e-27 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217727
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217852
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218862
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218863
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220142
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220277
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.8%
Validation Efficiency 98% (54/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the STAT protein family. In response to cytokines and growth factors, STAT family members are phosphorylated by the receptor associated kinases, and then form homo- or heterodimers that translocate to the cell nucleus where they act as transcription activators. In response to interferon (IFN), this protein forms a complex with STAT1 and IFN regulatory factor family protein p48 (ISGF3G), in which this protein acts as a transactivator, but lacks the ability to bind DNA directly. Transcription adaptor P300/CBP (EP300/CREBBP) has been shown to interact specifically with this protein, which is thought to be involved in the process of blocking IFN-alpha response by adenovirus. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2010]
PHENOTYPE: Immune response is impaired in homozygous null mice. [provided by MGI curators]
Allele List at MGI

All alleles(7) : Targeted, knock-out(1) Targeted, other(1) Gene trapped(4) Chemically induced(1)

Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Casc1 A G 6: 145,181,776 V469A probably benign Het
Ckap2l A T 2: 129,285,379 M293K probably benign Het
Col4a4 C T 1: 82,493,591 G681E unknown Het
Efcab7 G A 4: 99,878,170 R132H probably benign Het
Elovl4 T C 9: 83,780,764 T239A probably benign Het
Fank1 A G 7: 133,879,892 D240G probably damaging Het
Fbln5 T A 12: 101,757,444 M346L possibly damaging Het
Fbxl21 T C 13: 56,532,323 F174L probably benign Het
Gns A G 10: 121,380,185 D279G probably benign Het
Hmcn1 A G 1: 150,679,514 V2502A probably benign Het
Itgb4 C T 11: 115,984,157 R447W probably benign Het
Large2 A G 2: 92,374,743 probably benign Het
Lrrc8b A T 5: 105,480,252 I155F probably damaging Het
Morc2b T C 17: 33,138,379 I140V probably benign Het
Mrgprb5 G A 7: 48,168,048 S313L probably benign Het
Nectin4 A T 1: 171,383,705 T266S probably benign Het
Nsd1 C T 13: 55,247,346 A1023V possibly damaging Het
Olfr33 T C 7: 102,714,351 T21A probably benign Het
Paqr8 A G 1: 20,935,108 H162R possibly damaging Het
Pclo G A 5: 14,676,923 probably benign Het
Phactr4 T C 4: 132,370,982 D325G probably damaging Het
Plcg2 A T 8: 117,634,793 E1255V possibly damaging Het
Polr3a T C 14: 24,454,941 I1084V possibly damaging Het
Polr3b A T 10: 84,667,416 Q399L probably benign Het
Ppp1r35 G A 5: 137,780,024 probably benign Het
Psd3 A T 8: 67,713,725 D919E probably benign Het
Ptgs2 A G 1: 150,102,730 T198A possibly damaging Het
Ptpn14 T C 1: 189,832,800 probably null Het
Ptprk A G 10: 28,585,586 Y39C probably damaging Het
R3hdm4 A G 10: 79,913,341 Y75H probably benign Het
Rsph4a A G 10: 33,909,383 Y430C probably damaging Het
Samd12 C T 15: 53,860,273 C8Y probably damaging Het
Sema3e A C 5: 14,226,648 L314F probably damaging Het
Sis A G 3: 72,949,756 F401L probably damaging Het
Smoc1 T A 12: 81,104,700 S64T probably damaging Het
Socs5 T A 17: 87,134,341 H236Q probably damaging Het
Spaca1 C A 4: 34,049,863 R45L possibly damaging Het
Spag6 A G 2: 18,745,513 K457E probably benign Het
Tcp11l2 A G 10: 84,613,660 I496M probably damaging Het
Ttll4 A G 1: 74,686,376 I648V possibly damaging Het
Vmn2r67 T C 7: 85,152,245 Y161C probably damaging Het
Wnt5b A T 6: 119,433,852 V171E probably damaging Het
Zfp236 T C 18: 82,630,094 K933E probably damaging Het
Zfp236 T C 18: 82,658,073 E373G probably damaging Het
Zfp617 A G 8: 71,933,041 Y405C probably damaging Het
Zranb1 CTGATGATGATG CTGATGATGATGATG 7: 132,982,827 probably benign Het
Other mutations in Stat2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01833:Stat2 APN 10 128281176 missense probably benign 0.42
IGL02528:Stat2 APN 10 128290665 missense probably benign 0.07
IGL02859:Stat2 APN 10 128276611 missense probably damaging 1.00
IGL03119:Stat2 APN 10 128283517 missense probably benign 0.15
numb UTSW 10 128281065 splice site probably null
1mM(1):Stat2 UTSW 10 128277723 missense probably benign 0.06
R0098:Stat2 UTSW 10 128283262 missense probably damaging 1.00
R0334:Stat2 UTSW 10 128277867 missense probably damaging 1.00
R0496:Stat2 UTSW 10 128276509 missense probably benign 0.04
R1478:Stat2 UTSW 10 128282100 critical splice acceptor site probably null
R2857:Stat2 UTSW 10 128276901 splice site probably null
R3698:Stat2 UTSW 10 128278793 missense probably benign 0.30
R3870:Stat2 UTSW 10 128277893 missense probably benign 0.17
R5231:Stat2 UTSW 10 128281242 critical splice donor site probably null
R5235:Stat2 UTSW 10 128291032 critical splice donor site probably null
R5855:Stat2 UTSW 10 128283494 missense probably damaging 1.00
R6752:Stat2 UTSW 10 128283753 missense probably damaging 1.00
R7459:Stat2 UTSW 10 128276565 missense possibly damaging 0.95
R7467:Stat2 UTSW 10 128277903 splice site probably null
R7599:Stat2 UTSW 10 128277197 missense possibly damaging 0.45
R7756:Stat2 UTSW 10 128290728 small deletion probably benign
R7814:Stat2 UTSW 10 128290728 small deletion probably benign
R7992:Stat2 UTSW 10 128284962 missense probably damaging 1.00
R8335:Stat2 UTSW 10 128276583 missense possibly damaging 0.77
Predicted Primers PCR Primer
(F):5'- AGTGCTCTGCCATATGCTTC -3'
(R):5'- CTACAGACCTTTGGAGCAGACG -3'

Sequencing Primer
(F):5'- GGCTGACCTTGAACTCAGTCTATAG -3'
(R):5'- GACGCTGAAGTAACTCCATGACTTG -3'
Posted On2016-07-06