Incidental Mutation 'R5264:Morc2b'
ID401622
Institutional Source Beutler Lab
Gene Symbol Morc2b
Ensembl Gene ENSMUSG00000048602
Gene Namemicrorchidia 2B
Synonyms
MMRRC Submission 042832-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.253) question?
Stock #R5264 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location33135588-33139683 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 33138379 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 140 (I140V)
Ref Sequence ENSEMBL: ENSMUSP00000123354 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053896] [ENSMUST00000131954]
Predicted Effect probably benign
Transcript: ENSMUST00000053896
AA Change: I140V

PolyPhen 2 Score 0.028 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000056879
Gene: ENSMUSG00000048602
AA Change: I140V

DomainStartEndE-ValueType
HATPase_c 24 134 5.78e0 SMART
coiled coil region 285 321 N/A INTRINSIC
Pfam:zf-CW 495 541 1.9e-16 PFAM
coiled coil region 555 584 N/A INTRINSIC
low complexity region 680 695 N/A INTRINSIC
coiled coil region 961 1001 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000131954
AA Change: I140V

PolyPhen 2 Score 0.028 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000123354
Gene: ENSMUSG00000048602
AA Change: I140V

DomainStartEndE-ValueType
HATPase_c 24 134 5.78e0 SMART
coiled coil region 285 321 N/A INTRINSIC
Pfam:zf-CW 494 543 7.7e-18 PFAM
coiled coil region 555 584 N/A INTRINSIC
low complexity region 680 695 N/A INTRINSIC
coiled coil region 961 1001 N/A INTRINSIC
Meta Mutation Damage Score 0.0761 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.8%
Validation Efficiency 98% (54/55)
MGI Phenotype PHENOTYPE: Mice homozygous for a null mutation display male and female infertility with failure of chromosomal synapsis, double strand break repair, and recombination in meiosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Casc1 A G 6: 145,181,776 V469A probably benign Het
Ckap2l A T 2: 129,285,379 M293K probably benign Het
Col4a4 C T 1: 82,493,591 G681E unknown Het
Efcab7 G A 4: 99,878,170 R132H probably benign Het
Elovl4 T C 9: 83,780,764 T239A probably benign Het
Fank1 A G 7: 133,879,892 D240G probably damaging Het
Fbln5 T A 12: 101,757,444 M346L possibly damaging Het
Fbxl21 T C 13: 56,532,323 F174L probably benign Het
Gns A G 10: 121,380,185 D279G probably benign Het
Hmcn1 A G 1: 150,679,514 V2502A probably benign Het
Itgb4 C T 11: 115,984,157 R447W probably benign Het
Large2 A G 2: 92,374,743 probably benign Het
Lrrc8b A T 5: 105,480,252 I155F probably damaging Het
Mrgprb5 G A 7: 48,168,048 S313L probably benign Het
Nectin4 A T 1: 171,383,705 T266S probably benign Het
Nsd1 C T 13: 55,247,346 A1023V possibly damaging Het
Olfr33 T C 7: 102,714,351 T21A probably benign Het
Paqr8 A G 1: 20,935,108 H162R possibly damaging Het
Pclo G A 5: 14,676,923 probably benign Het
Phactr4 T C 4: 132,370,982 D325G probably damaging Het
Plcg2 A T 8: 117,634,793 E1255V possibly damaging Het
Polr3a T C 14: 24,454,941 I1084V possibly damaging Het
Polr3b A T 10: 84,667,416 Q399L probably benign Het
Ppp1r35 G A 5: 137,780,024 probably benign Het
Psd3 A T 8: 67,713,725 D919E probably benign Het
Ptgs2 A G 1: 150,102,730 T198A possibly damaging Het
Ptpn14 T C 1: 189,832,800 probably null Het
Ptprk A G 10: 28,585,586 Y39C probably damaging Het
R3hdm4 A G 10: 79,913,341 Y75H probably benign Het
Rsph4a A G 10: 33,909,383 Y430C probably damaging Het
Samd12 C T 15: 53,860,273 C8Y probably damaging Het
Sema3e A C 5: 14,226,648 L314F probably damaging Het
Sis A G 3: 72,949,756 F401L probably damaging Het
Smoc1 T A 12: 81,104,700 S64T probably damaging Het
Socs5 T A 17: 87,134,341 H236Q probably damaging Het
Spaca1 C A 4: 34,049,863 R45L possibly damaging Het
Spag6 A G 2: 18,745,513 K457E probably benign Het
Stat2 T A 10: 128,281,065 probably null Het
Tcp11l2 A G 10: 84,613,660 I496M probably damaging Het
Ttll4 A G 1: 74,686,376 I648V possibly damaging Het
Vmn2r67 T C 7: 85,152,245 Y161C probably damaging Het
Wnt5b A T 6: 119,433,852 V171E probably damaging Het
Zfp236 T C 18: 82,630,094 K933E probably damaging Het
Zfp236 T C 18: 82,658,073 E373G probably damaging Het
Zfp617 A G 8: 71,933,041 Y405C probably damaging Het
Zranb1 CTGATGATGATG CTGATGATGATGATG 7: 132,982,827 probably benign Het
Other mutations in Morc2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01323:Morc2b APN 17 33137319 missense possibly damaging 0.47
IGL01369:Morc2b APN 17 33138165 missense probably benign 0.12
IGL01533:Morc2b APN 17 33135721 utr 3 prime probably benign
IGL02003:Morc2b APN 17 33138324 missense probably benign 0.07
IGL02028:Morc2b APN 17 33137413 missense possibly damaging 0.78
IGL02152:Morc2b APN 17 33137943 missense probably damaging 1.00
IGL02341:Morc2b APN 17 33137307 missense probably damaging 1.00
IGL02976:Morc2b APN 17 33137523 missense possibly damaging 0.90
IGL03293:Morc2b APN 17 33138363 missense probably damaging 1.00
PIT4283001:Morc2b UTSW 17 33136068 missense probably benign 0.00
R0056:Morc2b UTSW 17 33138759 missense possibly damaging 0.78
R0116:Morc2b UTSW 17 33137041 missense probably damaging 1.00
R0179:Morc2b UTSW 17 33136982 nonsense probably null
R0533:Morc2b UTSW 17 33135932 nonsense probably null
R0556:Morc2b UTSW 17 33137838 missense probably benign 0.05
R0629:Morc2b UTSW 17 33135807 missense probably benign 0.00
R0635:Morc2b UTSW 17 33137687 missense possibly damaging 0.90
R0840:Morc2b UTSW 17 33136112 missense probably benign 0.01
R1205:Morc2b UTSW 17 33135934 missense probably damaging 1.00
R1566:Morc2b UTSW 17 33136974 missense probably benign 0.02
R1676:Morc2b UTSW 17 33135981 missense possibly damaging 0.82
R1892:Morc2b UTSW 17 33135774 missense probably damaging 1.00
R1954:Morc2b UTSW 17 33137490 missense probably damaging 1.00
R1955:Morc2b UTSW 17 33137490 missense probably damaging 1.00
R1969:Morc2b UTSW 17 33137091 missense probably benign 0.00
R2069:Morc2b UTSW 17 33136760 missense probably benign 0.13
R3609:Morc2b UTSW 17 33136278 missense probably damaging 1.00
R3610:Morc2b UTSW 17 33136278 missense probably damaging 1.00
R3831:Morc2b UTSW 17 33137259 missense probably benign 0.01
R4156:Morc2b UTSW 17 33138427 missense probably benign 0.43
R4243:Morc2b UTSW 17 33136401 missense probably benign 0.03
R4877:Morc2b UTSW 17 33138738 missense probably benign 0.26
R4911:Morc2b UTSW 17 33137377 missense probably damaging 1.00
R5230:Morc2b UTSW 17 33136252 missense probably benign 0.00
R5326:Morc2b UTSW 17 33136933 missense probably benign 0.01
R5455:Morc2b UTSW 17 33138610 missense probably benign 0.29
R5933:Morc2b UTSW 17 33138609 missense possibly damaging 0.84
R5973:Morc2b UTSW 17 33137472 missense probably damaging 0.97
R6026:Morc2b UTSW 17 33137983 missense possibly damaging 0.55
R6113:Morc2b UTSW 17 33138068 nonsense probably null
R6393:Morc2b UTSW 17 33137776 missense probably damaging 0.97
R7066:Morc2b UTSW 17 33136636 missense probably benign 0.00
R7117:Morc2b UTSW 17 33137952 missense probably benign 0.00
R7120:Morc2b UTSW 17 33135813 missense probably damaging 1.00
R7130:Morc2b UTSW 17 33136288 missense possibly damaging 0.68
R7498:Morc2b UTSW 17 33137859 missense possibly damaging 0.55
R7516:Morc2b UTSW 17 33137461 missense probably benign 0.03
R7664:Morc2b UTSW 17 33136402 missense probably benign 0.12
R7754:Morc2b UTSW 17 33137244 missense probably benign 0.33
R7756:Morc2b UTSW 17 33137007 missense probably damaging 1.00
R7758:Morc2b UTSW 17 33137007 missense probably damaging 1.00
R7766:Morc2b UTSW 17 33138423 missense probably benign 0.19
Z1088:Morc2b UTSW 17 33136086 missense possibly damaging 0.49
Z1177:Morc2b UTSW 17 33137402 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAATGACGACCAGGGTTCCAC -3'
(R):5'- AATGGAGTCGGAATGGATCC -3'

Sequencing Primer
(F):5'- GGGTTCCACTAGTCCCAGAAATC -3'
(R):5'- CGATGTCATCAATGTGATCCAG -3'
Posted On2016-07-06