Incidental Mutation 'R5265:Pikfyve'
ID 401626
Institutional Source Beutler Lab
Gene Symbol Pikfyve
Ensembl Gene ENSMUSG00000025949
Gene Name phosphoinositide kinase, FYVE type zinc finger containing
Synonyms PipkIII, Pip5k3, 5230400C17Rik
MMRRC Submission 042833-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R5265 (G1)
Quality Score 225
Status Validated
Chromosome 1
Chromosomal Location 65225842-65317854 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 65306988 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 1747 (E1747G)
Ref Sequence ENSEMBL: ENSMUSP00000079926 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081154] [ENSMUST00000097707]
AlphaFold Q9Z1T6
Predicted Effect possibly damaging
Transcript: ENSMUST00000081154
AA Change: E1747G

PolyPhen 2 Score 0.719 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000079926
Gene: ENSMUSG00000025949
AA Change: E1747G

DomainStartEndE-ValueType
low complexity region 58 81 N/A INTRINSIC
FYVE 161 230 5.95e-18 SMART
DEP 376 451 9.05e-27 SMART
Pfam:Cpn60_TCP1 547 822 2e-37 PFAM
low complexity region 1177 1189 N/A INTRINSIC
low complexity region 1516 1536 N/A INTRINSIC
PIPKc 1745 2039 3.03e-162 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000097707
AA Change: E1792G

PolyPhen 2 Score 0.325 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000095314
Gene: ENSMUSG00000025949
AA Change: E1792G

DomainStartEndE-ValueType
low complexity region 58 81 N/A INTRINSIC
FYVE 150 219 5.95e-18 SMART
DEP 365 440 9.05e-27 SMART
Pfam:Cpn60_TCP1 590 864 1.8e-35 PFAM
low complexity region 1222 1234 N/A INTRINSIC
low complexity region 1561 1581 N/A INTRINSIC
PIPKc 1790 2084 3.03e-162 SMART
Meta Mutation Damage Score 0.0610 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.7%
Validation Efficiency 100% (59/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Phosphorylated derivatives of phosphatidylinositol (PtdIns) regulate cytoskeletal functions, membrane trafficking, and receptor signaling by recruiting protein complexes to cell- and endosomal-membranes. Humans have multiple PtdIns proteins that differ by the degree and position of phosphorylation of the inositol ring. This gene encodes an enzyme (PIKfyve; also known as phosphatidylinositol-3-phosphate 5-kinase type III or PIPKIII) that phosphorylates the D-5 position in PtdIns and phosphatidylinositol-3-phosphate (PtdIns3P) to make PtdIns5P and PtdIns(3,5)biphosphate. The D-5 position also can be phosphorylated by type I PtdIns4P-5-kinases (PIP5Ks) that are encoded by distinct genes and preferentially phosphorylate D-4 phosphorylated PtdIns. In contrast, PIKfyve preferentially phosphorylates D-3 phosphorylated PtdIns. In addition to being a lipid kinase, PIKfyve also has protein kinase activity. PIKfyve regulates endomembrane homeostasis and plays a role in the biogenesis of endosome carrier vesicles from early endosomes. Mutations in this gene cause corneal fleck dystrophy (CFD); an autosomal dominant disorder characterized by numerous small white flecks present in all layers of the corneal stroma. Histologically, these flecks appear to be keratocytes distended with lipid and mucopolysaccharide filled intracytoplasmic vacuoles. Alternative splicing results in multiple transcript variants encoding distinct isoforms.[provided by RefSeq, May 2010]
PHENOTYPE: Mice homozygous for a null allele die prior to implantation with reduced numbers of inner cell mass and trophectoderm cells and blastocoele abnormalities. Mice homozygous for a second null allele show embryonic lethality between somite formation and embryo turning with abnormal visceral endoderm. [provided by MGI curators]
Allele List at MGI

All alleles(16) : Gene trapped(16)

Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017B05Rik A G 9: 57,166,177 (GRCm39) W66R probably damaging Het
Adamts3 A G 5: 90,009,411 (GRCm39) V84A possibly damaging Het
Caap1 C A 4: 94,389,465 (GRCm39) E290* probably null Het
Cant1 G A 11: 118,298,876 (GRCm39) R296C probably damaging Het
Cdh5 A T 8: 104,869,371 (GRCm39) H699L probably benign Het
Cfdp1 T C 8: 112,557,617 (GRCm39) T175A probably benign Het
Col4a4 C T 1: 82,471,312 (GRCm39) G681E unknown Het
Comtd1 G A 14: 21,898,861 (GRCm39) T27I probably benign Het
Copg1 T A 6: 87,869,252 (GRCm39) V155D probably damaging Het
Dag1 A G 9: 108,084,898 (GRCm39) Y748H possibly damaging Het
Dmwd T A 7: 18,814,206 (GRCm39) N285K possibly damaging Het
Dsp A G 13: 38,379,159 (GRCm39) E1968G possibly damaging Het
Ednra A G 8: 78,394,004 (GRCm39) I364T probably damaging Het
Elovl3 C A 19: 46,123,120 (GRCm39) T232K probably damaging Het
Ercc3 T A 18: 32,387,296 (GRCm39) I503N probably damaging Het
Ercc6 C A 14: 32,291,580 (GRCm39) A1008D probably benign Het
Gm10563 TTTC TTTCATTC 4: 155,698,953 (GRCm39) probably null Het
H2-DMb2 G T 17: 34,367,536 (GRCm39) V117F probably damaging Het
Helt A T 8: 46,745,470 (GRCm39) W138R probably damaging Het
Itga11 A T 9: 62,644,694 (GRCm39) H215L probably benign Het
Kcnn1 T A 8: 71,307,297 (GRCm39) I156F probably benign Het
Kdm1b A G 13: 47,216,445 (GRCm39) N272D probably benign Het
Kdm2b T C 5: 123,016,651 (GRCm39) T1161A probably damaging Het
Lin54 A G 5: 100,633,378 (GRCm39) L102P probably damaging Het
Mlh1 A C 9: 111,100,591 (GRCm39) M1R probably null Het
Naip2 G A 13: 100,289,068 (GRCm39) L1165F probably damaging Het
Nfkbiz A G 16: 55,640,004 (GRCm39) S118P probably damaging Het
Nkx3-2 T A 5: 41,919,191 (GRCm39) M266L probably benign Het
Npr1 T C 3: 90,364,309 (GRCm39) E771G probably benign Het
Obox8 C T 7: 14,065,954 (GRCm39) R188H probably benign Het
Odad1 T A 7: 45,596,859 (GRCm39) D395E probably damaging Het
Or5h19 A T 16: 58,856,506 (GRCm39) V198D possibly damaging Het
Or5p72 T A 7: 108,022,609 (GRCm39) V277E possibly damaging Het
Palm3 T C 8: 84,748,159 (GRCm39) probably null Het
Palmd A T 3: 116,717,498 (GRCm39) V333D possibly damaging Het
Polr3a T C 14: 24,505,009 (GRCm39) I1084V possibly damaging Het
Ranbp3l T A 15: 9,037,077 (GRCm39) F127I probably benign Het
Rsl1d1 A G 16: 11,019,248 (GRCm39) F97L possibly damaging Het
Scaper A G 9: 55,771,830 (GRCm39) V362A probably benign Het
Scg5 A T 2: 113,607,210 (GRCm39) L192* probably null Het
Slc34a2 T C 5: 53,218,776 (GRCm39) I198T probably damaging Het
Slc45a3 T A 1: 131,905,932 (GRCm39) D318E possibly damaging Het
Sorl1 A G 9: 42,017,812 (GRCm39) M105T possibly damaging Het
St3gal5 T A 6: 72,126,115 (GRCm39) I320N probably damaging Het
Stx17 A G 4: 48,183,470 (GRCm39) probably benign Het
Syt5 C T 7: 4,544,074 (GRCm39) probably null Het
Thrap3 A G 4: 126,061,433 (GRCm39) S774P probably damaging Het
Tnc A T 4: 63,911,443 (GRCm39) M1376K probably benign Het
Tnks1bp1 T A 2: 84,893,098 (GRCm39) D1008E probably benign Het
Trav7-1 G T 14: 52,892,761 (GRCm39) A105S probably damaging Het
Vmn1r28 T A 6: 58,242,949 (GRCm39) V264D probably damaging Het
Vmn1r44 T C 6: 89,870,821 (GRCm39) V46A probably benign Het
Vmn2r10 A G 5: 109,143,586 (GRCm39) I788T probably damaging Het
Vmn2r78 T A 7: 86,569,332 (GRCm39) I75N probably damaging Het
Zfp821 T C 8: 110,450,991 (GRCm39) M328T probably damaging Het
Zfp995 G A 17: 22,099,604 (GRCm39) P210L possibly damaging Het
Other mutations in Pikfyve
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00162:Pikfyve APN 1 65,299,280 (GRCm39) critical splice donor site probably null
IGL01135:Pikfyve APN 1 65,290,794 (GRCm39) missense probably damaging 0.96
IGL01511:Pikfyve APN 1 65,298,028 (GRCm39) nonsense probably null
IGL01759:Pikfyve APN 1 65,292,512 (GRCm39) missense probably benign 0.06
IGL01888:Pikfyve APN 1 65,262,799 (GRCm39) missense probably damaging 1.00
IGL01967:Pikfyve APN 1 65,303,524 (GRCm39) missense possibly damaging 0.89
IGL02055:Pikfyve APN 1 65,277,703 (GRCm39) critical splice donor site probably null
IGL02119:Pikfyve APN 1 65,311,730 (GRCm39) missense probably damaging 1.00
IGL02141:Pikfyve APN 1 65,285,556 (GRCm39) missense probably benign 0.13
IGL02207:Pikfyve APN 1 65,290,837 (GRCm39) critical splice donor site probably null
IGL02380:Pikfyve APN 1 65,295,180 (GRCm39) missense probably damaging 0.99
IGL02400:Pikfyve APN 1 65,291,728 (GRCm39) missense probably damaging 1.00
IGL02403:Pikfyve APN 1 65,283,663 (GRCm39) missense probably damaging 0.99
IGL02426:Pikfyve APN 1 65,290,771 (GRCm39) missense possibly damaging 0.77
IGL02496:Pikfyve APN 1 65,303,535 (GRCm39) missense possibly damaging 0.94
IGL02573:Pikfyve APN 1 65,270,014 (GRCm39) critical splice donor site probably null
IGL02746:Pikfyve APN 1 65,273,431 (GRCm39) missense probably damaging 1.00
IGL02814:Pikfyve APN 1 65,289,353 (GRCm39) nonsense probably null
IGL02890:Pikfyve APN 1 65,269,956 (GRCm39) missense probably benign 0.00
IGL03102:Pikfyve APN 1 65,291,626 (GRCm39) nonsense probably null
IGL03294:Pikfyve APN 1 65,286,226 (GRCm39) missense probably damaging 1.00
falcon UTSW 1 65,235,900 (GRCm39) missense probably damaging 1.00
oompa UTSW 1 65,235,865 (GRCm39) missense probably damaging 1.00
wonka UTSW 1 65,235,865 (GRCm39) missense probably damaging 1.00
G5538:Pikfyve UTSW 1 65,242,075 (GRCm39) missense probably damaging 1.00
R0031:Pikfyve UTSW 1 65,255,088 (GRCm39) splice site probably benign
R0196:Pikfyve UTSW 1 65,295,231 (GRCm39) missense possibly damaging 0.92
R0212:Pikfyve UTSW 1 65,302,064 (GRCm39) missense probably benign 0.41
R0319:Pikfyve UTSW 1 65,285,490 (GRCm39) missense probably benign 0.01
R0332:Pikfyve UTSW 1 65,303,558 (GRCm39) missense probably benign 0.02
R0389:Pikfyve UTSW 1 65,235,865 (GRCm39) missense probably damaging 1.00
R0443:Pikfyve UTSW 1 65,235,865 (GRCm39) missense probably damaging 1.00
R0503:Pikfyve UTSW 1 65,259,058 (GRCm39) missense probably damaging 0.97
R0722:Pikfyve UTSW 1 65,292,682 (GRCm39) missense probably damaging 0.99
R0906:Pikfyve UTSW 1 65,292,556 (GRCm39) missense probably damaging 1.00
R0907:Pikfyve UTSW 1 65,241,989 (GRCm39) missense possibly damaging 0.64
R0970:Pikfyve UTSW 1 65,304,983 (GRCm39) missense probably damaging 0.99
R1188:Pikfyve UTSW 1 65,286,118 (GRCm39) missense possibly damaging 0.46
R1412:Pikfyve UTSW 1 65,241,989 (GRCm39) missense possibly damaging 0.64
R1421:Pikfyve UTSW 1 65,310,470 (GRCm39) missense probably damaging 1.00
R1468:Pikfyve UTSW 1 65,290,825 (GRCm39) missense probably damaging 0.98
R1468:Pikfyve UTSW 1 65,290,825 (GRCm39) missense probably damaging 0.98
R1472:Pikfyve UTSW 1 65,263,360 (GRCm39) missense probably damaging 0.96
R1478:Pikfyve UTSW 1 65,302,136 (GRCm39) critical splice donor site probably null
R1501:Pikfyve UTSW 1 65,304,443 (GRCm39) missense possibly damaging 0.84
R1757:Pikfyve UTSW 1 65,291,707 (GRCm39) missense probably damaging 0.99
R1773:Pikfyve UTSW 1 65,285,529 (GRCm39) missense probably benign
R1773:Pikfyve UTSW 1 65,231,430 (GRCm39) missense probably damaging 0.99
R1795:Pikfyve UTSW 1 65,291,716 (GRCm39) missense probably damaging 1.00
R1855:Pikfyve UTSW 1 65,297,957 (GRCm39) missense probably benign 0.03
R1905:Pikfyve UTSW 1 65,231,454 (GRCm39) critical splice donor site probably null
R1995:Pikfyve UTSW 1 65,285,867 (GRCm39) missense probably damaging 1.00
R2034:Pikfyve UTSW 1 65,261,516 (GRCm39) missense probably damaging 1.00
R2045:Pikfyve UTSW 1 65,292,512 (GRCm39) missense probably benign 0.06
R2229:Pikfyve UTSW 1 65,307,014 (GRCm39) missense probably damaging 1.00
R2295:Pikfyve UTSW 1 65,285,835 (GRCm39) missense probably damaging 0.99
R2913:Pikfyve UTSW 1 65,292,676 (GRCm39) missense probably damaging 1.00
R3818:Pikfyve UTSW 1 65,284,917 (GRCm39) missense probably damaging 1.00
R3832:Pikfyve UTSW 1 65,283,579 (GRCm39) missense probably damaging 0.99
R3850:Pikfyve UTSW 1 65,270,004 (GRCm39) missense probably damaging 1.00
R3946:Pikfyve UTSW 1 65,235,840 (GRCm39) missense probably damaging 1.00
R4105:Pikfyve UTSW 1 65,229,679 (GRCm39) unclassified probably benign
R4542:Pikfyve UTSW 1 65,283,589 (GRCm39) missense probably damaging 1.00
R4574:Pikfyve UTSW 1 65,231,351 (GRCm39) missense probably damaging 1.00
R4601:Pikfyve UTSW 1 65,273,421 (GRCm39) missense probably damaging 1.00
R4667:Pikfyve UTSW 1 65,289,432 (GRCm39) missense probably damaging 1.00
R4668:Pikfyve UTSW 1 65,289,432 (GRCm39) missense probably damaging 1.00
R4669:Pikfyve UTSW 1 65,289,432 (GRCm39) missense probably damaging 1.00
R4707:Pikfyve UTSW 1 65,307,005 (GRCm39) missense probably benign
R4716:Pikfyve UTSW 1 65,285,635 (GRCm39) missense possibly damaging 0.84
R4758:Pikfyve UTSW 1 65,311,674 (GRCm39) missense possibly damaging 0.84
R4784:Pikfyve UTSW 1 65,307,005 (GRCm39) missense probably benign
R4785:Pikfyve UTSW 1 65,307,005 (GRCm39) missense probably benign
R4805:Pikfyve UTSW 1 65,307,959 (GRCm39) missense probably damaging 0.99
R4831:Pikfyve UTSW 1 65,235,900 (GRCm39) missense probably damaging 1.00
R4837:Pikfyve UTSW 1 65,285,749 (GRCm39) missense possibly damaging 0.92
R5064:Pikfyve UTSW 1 65,292,566 (GRCm39) missense probably damaging 1.00
R5115:Pikfyve UTSW 1 65,263,276 (GRCm39) intron probably benign
R5279:Pikfyve UTSW 1 65,235,858 (GRCm39) nonsense probably null
R5384:Pikfyve UTSW 1 65,283,568 (GRCm39) missense probably damaging 1.00
R5387:Pikfyve UTSW 1 65,304,427 (GRCm39) missense possibly damaging 0.94
R5461:Pikfyve UTSW 1 65,274,192 (GRCm39) missense probably damaging 1.00
R5467:Pikfyve UTSW 1 65,291,654 (GRCm39) missense probably damaging 1.00
R5560:Pikfyve UTSW 1 65,292,566 (GRCm39) missense probably damaging 1.00
R5575:Pikfyve UTSW 1 65,312,889 (GRCm39) missense probably damaging 1.00
R5611:Pikfyve UTSW 1 65,295,247 (GRCm39) missense probably damaging 0.96
R5663:Pikfyve UTSW 1 65,255,187 (GRCm39) missense probably benign 0.09
R5891:Pikfyve UTSW 1 65,241,896 (GRCm39) missense probably damaging 1.00
R5960:Pikfyve UTSW 1 65,292,597 (GRCm39) nonsense probably null
R6026:Pikfyve UTSW 1 65,311,856 (GRCm39) missense probably damaging 1.00
R6057:Pikfyve UTSW 1 65,311,730 (GRCm39) missense probably damaging 1.00
R6101:Pikfyve UTSW 1 65,303,504 (GRCm39) critical splice acceptor site probably null
R6105:Pikfyve UTSW 1 65,303,504 (GRCm39) critical splice acceptor site probably null
R6161:Pikfyve UTSW 1 65,255,202 (GRCm39) missense probably benign 0.36
R6287:Pikfyve UTSW 1 65,292,691 (GRCm39) critical splice donor site probably null
R6290:Pikfyve UTSW 1 65,242,084 (GRCm39) critical splice donor site probably null
R6296:Pikfyve UTSW 1 65,302,112 (GRCm39) missense probably damaging 0.99
R6516:Pikfyve UTSW 1 65,304,940 (GRCm39) missense probably benign 0.35
R6835:Pikfyve UTSW 1 65,298,002 (GRCm39) missense probably damaging 0.98
R6994:Pikfyve UTSW 1 65,291,689 (GRCm39) missense probably damaging 1.00
R6997:Pikfyve UTSW 1 65,285,822 (GRCm39) missense probably damaging 1.00
R7038:Pikfyve UTSW 1 65,273,520 (GRCm39) missense probably damaging 1.00
R7044:Pikfyve UTSW 1 65,286,013 (GRCm39) missense probably benign 0.01
R7057:Pikfyve UTSW 1 65,286,364 (GRCm39) missense probably benign 0.00
R7525:Pikfyve UTSW 1 65,283,585 (GRCm39) nonsense probably null
R7558:Pikfyve UTSW 1 65,311,782 (GRCm39) missense probably benign 0.01
R7625:Pikfyve UTSW 1 65,307,036 (GRCm39) missense possibly damaging 0.86
R7807:Pikfyve UTSW 1 65,309,101 (GRCm39) missense probably damaging 1.00
R7961:Pikfyve UTSW 1 65,294,293 (GRCm39) missense probably damaging 1.00
R8009:Pikfyve UTSW 1 65,294,293 (GRCm39) missense probably damaging 1.00
R8154:Pikfyve UTSW 1 65,304,948 (GRCm39) missense probably damaging 1.00
R8192:Pikfyve UTSW 1 65,285,554 (GRCm39) missense possibly damaging 0.93
R8275:Pikfyve UTSW 1 65,292,501 (GRCm39) splice site probably benign
R8307:Pikfyve UTSW 1 65,284,894 (GRCm39) missense possibly damaging 0.77
R8710:Pikfyve UTSW 1 65,255,155 (GRCm39) missense possibly damaging 0.94
R8867:Pikfyve UTSW 1 65,283,576 (GRCm39) missense probably damaging 1.00
R8936:Pikfyve UTSW 1 65,310,427 (GRCm39) missense possibly damaging 0.84
R8940:Pikfyve UTSW 1 65,286,129 (GRCm39) missense probably benign 0.00
R8995:Pikfyve UTSW 1 65,244,746 (GRCm39) critical splice acceptor site probably null
R9092:Pikfyve UTSW 1 65,283,559 (GRCm39) missense probably damaging 1.00
R9131:Pikfyve UTSW 1 65,285,239 (GRCm39) missense probably damaging 1.00
R9151:Pikfyve UTSW 1 65,235,898 (GRCm39) missense probably damaging 1.00
R9210:Pikfyve UTSW 1 65,291,719 (GRCm39) missense probably damaging 1.00
R9212:Pikfyve UTSW 1 65,291,719 (GRCm39) missense probably damaging 1.00
R9235:Pikfyve UTSW 1 65,299,188 (GRCm39) missense probably benign 0.37
R9368:Pikfyve UTSW 1 65,307,901 (GRCm39) missense probably damaging 1.00
R9489:Pikfyve UTSW 1 65,303,561 (GRCm39) missense probably benign
R9605:Pikfyve UTSW 1 65,303,561 (GRCm39) missense probably benign
R9686:Pikfyve UTSW 1 65,291,615 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCTGAAATATTGAAATCCCAGG -3'
(R):5'- CAAACATCTTAGTGCTCGCC -3'

Sequencing Primer
(F):5'- TGCACAATTTGTCTGTCTA -3'
(R):5'- GCCAAGCTCTACATCTCTCAATTAC -3'
Posted On 2016-07-06