Incidental Mutation 'R5265:Slc45a3'
ID 401628
Institutional Source Beutler Lab
Gene Symbol Slc45a3
Ensembl Gene ENSMUSG00000026435
Gene Name solute carrier family 45, member 3
Synonyms Pcanap6, 2210413P12Rik, IPCA-6
MMRRC Submission 042833-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R5265 (G1)
Quality Score 225
Status Validated
Chromosome 1
Chromosomal Location 131890705-131910707 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 131905932 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 318 (D318E)
Ref Sequence ENSEMBL: ENSMUSP00000136190 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027695] [ENSMUST00000177943] [ENSMUST00000190322]
AlphaFold Q8K0H7
Predicted Effect possibly damaging
Transcript: ENSMUST00000027695
AA Change: D318E

PolyPhen 2 Score 0.460 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000027695
Gene: ENSMUSG00000026435
AA Change: D318E

DomainStartEndE-ValueType
Pfam:MFS_1 18 306 1.2e-12 PFAM
Pfam:MFS_2 21 408 5.4e-11 PFAM
transmembrane domain 520 542 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000177943
AA Change: D318E

PolyPhen 2 Score 0.460 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000136190
Gene: ENSMUSG00000026435
AA Change: D318E

DomainStartEndE-ValueType
Pfam:MFS_1 18 306 1.5e-12 PFAM
Pfam:MFS_2 19 239 2.4e-13 PFAM
transmembrane domain 320 342 N/A INTRINSIC
transmembrane domain 355 377 N/A INTRINSIC
transmembrane domain 382 404 N/A INTRINSIC
transmembrane domain 520 542 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185387
Predicted Effect probably benign
Transcript: ENSMUST00000190322
SMART Domains Protein: ENSMUSP00000140767
Gene: ENSMUSG00000026435

DomainStartEndE-ValueType
Pfam:MFS_2 20 218 3.3e-9 PFAM
Pfam:MFS_1 51 219 1.7e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191034
Meta Mutation Damage Score 0.0746 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.7%
Validation Efficiency 100% (59/59)
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017B05Rik A G 9: 57,166,177 (GRCm39) W66R probably damaging Het
Adamts3 A G 5: 90,009,411 (GRCm39) V84A possibly damaging Het
Caap1 C A 4: 94,389,465 (GRCm39) E290* probably null Het
Cant1 G A 11: 118,298,876 (GRCm39) R296C probably damaging Het
Cdh5 A T 8: 104,869,371 (GRCm39) H699L probably benign Het
Cfdp1 T C 8: 112,557,617 (GRCm39) T175A probably benign Het
Col4a4 C T 1: 82,471,312 (GRCm39) G681E unknown Het
Comtd1 G A 14: 21,898,861 (GRCm39) T27I probably benign Het
Copg1 T A 6: 87,869,252 (GRCm39) V155D probably damaging Het
Dag1 A G 9: 108,084,898 (GRCm39) Y748H possibly damaging Het
Dmwd T A 7: 18,814,206 (GRCm39) N285K possibly damaging Het
Dsp A G 13: 38,379,159 (GRCm39) E1968G possibly damaging Het
Ednra A G 8: 78,394,004 (GRCm39) I364T probably damaging Het
Elovl3 C A 19: 46,123,120 (GRCm39) T232K probably damaging Het
Ercc3 T A 18: 32,387,296 (GRCm39) I503N probably damaging Het
Ercc6 C A 14: 32,291,580 (GRCm39) A1008D probably benign Het
Gm10563 TTTC TTTCATTC 4: 155,698,953 (GRCm39) probably null Het
H2-DMb2 G T 17: 34,367,536 (GRCm39) V117F probably damaging Het
Helt A T 8: 46,745,470 (GRCm39) W138R probably damaging Het
Itga11 A T 9: 62,644,694 (GRCm39) H215L probably benign Het
Kcnn1 T A 8: 71,307,297 (GRCm39) I156F probably benign Het
Kdm1b A G 13: 47,216,445 (GRCm39) N272D probably benign Het
Kdm2b T C 5: 123,016,651 (GRCm39) T1161A probably damaging Het
Lin54 A G 5: 100,633,378 (GRCm39) L102P probably damaging Het
Mlh1 A C 9: 111,100,591 (GRCm39) M1R probably null Het
Naip2 G A 13: 100,289,068 (GRCm39) L1165F probably damaging Het
Nfkbiz A G 16: 55,640,004 (GRCm39) S118P probably damaging Het
Nkx3-2 T A 5: 41,919,191 (GRCm39) M266L probably benign Het
Npr1 T C 3: 90,364,309 (GRCm39) E771G probably benign Het
Obox8 C T 7: 14,065,954 (GRCm39) R188H probably benign Het
Odad1 T A 7: 45,596,859 (GRCm39) D395E probably damaging Het
Or5h19 A T 16: 58,856,506 (GRCm39) V198D possibly damaging Het
Or5p72 T A 7: 108,022,609 (GRCm39) V277E possibly damaging Het
Palm3 T C 8: 84,748,159 (GRCm39) probably null Het
Palmd A T 3: 116,717,498 (GRCm39) V333D possibly damaging Het
Pikfyve A G 1: 65,306,988 (GRCm39) E1747G possibly damaging Het
Polr3a T C 14: 24,505,009 (GRCm39) I1084V possibly damaging Het
Ranbp3l T A 15: 9,037,077 (GRCm39) F127I probably benign Het
Rsl1d1 A G 16: 11,019,248 (GRCm39) F97L possibly damaging Het
Scaper A G 9: 55,771,830 (GRCm39) V362A probably benign Het
Scg5 A T 2: 113,607,210 (GRCm39) L192* probably null Het
Slc34a2 T C 5: 53,218,776 (GRCm39) I198T probably damaging Het
Sorl1 A G 9: 42,017,812 (GRCm39) M105T possibly damaging Het
St3gal5 T A 6: 72,126,115 (GRCm39) I320N probably damaging Het
Stx17 A G 4: 48,183,470 (GRCm39) probably benign Het
Syt5 C T 7: 4,544,074 (GRCm39) probably null Het
Thrap3 A G 4: 126,061,433 (GRCm39) S774P probably damaging Het
Tnc A T 4: 63,911,443 (GRCm39) M1376K probably benign Het
Tnks1bp1 T A 2: 84,893,098 (GRCm39) D1008E probably benign Het
Trav7-1 G T 14: 52,892,761 (GRCm39) A105S probably damaging Het
Vmn1r28 T A 6: 58,242,949 (GRCm39) V264D probably damaging Het
Vmn1r44 T C 6: 89,870,821 (GRCm39) V46A probably benign Het
Vmn2r10 A G 5: 109,143,586 (GRCm39) I788T probably damaging Het
Vmn2r78 T A 7: 86,569,332 (GRCm39) I75N probably damaging Het
Zfp821 T C 8: 110,450,991 (GRCm39) M328T probably damaging Het
Zfp995 G A 17: 22,099,604 (GRCm39) P210L possibly damaging Het
Other mutations in Slc45a3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00962:Slc45a3 APN 1 131,905,265 (GRCm39) missense probably damaging 0.98
IGL01626:Slc45a3 APN 1 131,906,725 (GRCm39) missense possibly damaging 0.73
IGL01677:Slc45a3 APN 1 131,906,708 (GRCm39) missense probably damaging 0.99
F6893:Slc45a3 UTSW 1 131,909,075 (GRCm39) missense probably benign
R0122:Slc45a3 UTSW 1 131,905,478 (GRCm39) missense probably damaging 1.00
R0402:Slc45a3 UTSW 1 131,905,265 (GRCm39) missense possibly damaging 0.85
R1596:Slc45a3 UTSW 1 131,909,267 (GRCm39) missense probably damaging 1.00
R1647:Slc45a3 UTSW 1 131,905,262 (GRCm39) missense probably damaging 1.00
R1752:Slc45a3 UTSW 1 131,905,259 (GRCm39) missense probably damaging 1.00
R1771:Slc45a3 UTSW 1 131,904,694 (GRCm39) missense possibly damaging 0.51
R1776:Slc45a3 UTSW 1 131,904,694 (GRCm39) missense possibly damaging 0.51
R2071:Slc45a3 UTSW 1 131,905,370 (GRCm39) missense probably damaging 1.00
R2939:Slc45a3 UTSW 1 131,905,637 (GRCm39) missense probably damaging 1.00
R4230:Slc45a3 UTSW 1 131,909,399 (GRCm39) missense probably damaging 0.96
R4876:Slc45a3 UTSW 1 131,909,285 (GRCm39) missense possibly damaging 0.48
R4906:Slc45a3 UTSW 1 131,909,315 (GRCm39) missense probably damaging 1.00
R5964:Slc45a3 UTSW 1 131,905,811 (GRCm39) missense probably damaging 0.98
R6849:Slc45a3 UTSW 1 131,905,702 (GRCm39) missense probably damaging 1.00
R7483:Slc45a3 UTSW 1 131,904,549 (GRCm39) start gained probably benign
R8104:Slc45a3 UTSW 1 131,904,754 (GRCm39) missense probably benign 0.29
R8322:Slc45a3 UTSW 1 131,905,523 (GRCm39) missense probably damaging 0.99
R8333:Slc45a3 UTSW 1 131,905,928 (GRCm39) missense probably damaging 1.00
R9011:Slc45a3 UTSW 1 131,905,714 (GRCm39) missense probably benign 0.02
R9035:Slc45a3 UTSW 1 131,909,187 (GRCm39) frame shift probably null
R9101:Slc45a3 UTSW 1 131,905,175 (GRCm39) missense possibly damaging 0.51
Predicted Primers PCR Primer
(F):5'- GCTTTCCGGAATCTGGGTAC -3'
(R):5'- ATAGACCTAGAAGCCCTACTGAG -3'

Sequencing Primer
(F):5'- TGTTTCCCCGGCTGCAG -3'
(R):5'- CAGCAGCAGTGTTCATGAGCTAC -3'
Posted On 2016-07-06