Incidental Mutation 'R0414:Mug1'
ID40163
Institutional Source Beutler Lab
Gene Symbol Mug1
Ensembl Gene ENSMUSG00000059908
Gene Namemurinoglobulin 1
Synonyms
MMRRC Submission 038616-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0414 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location121838541-121889057 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 121856554 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 325 (F325L)
Ref Sequence ENSEMBL: ENSMUSP00000032228 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032228]
Predicted Effect probably benign
Transcript: ENSMUST00000032228
AA Change: F325L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000032228
Gene: ENSMUSG00000059908
AA Change: F325L

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:A2M_N 128 221 5e-21 PFAM
A2M_N_2 449 599 2.55e-41 SMART
A2M 740 830 5.43e-36 SMART
Pfam:Thiol-ester_cl 963 992 1e-18 PFAM
Pfam:A2M_comp 1012 1268 5.4e-94 PFAM
A2M_recep 1378 1465 4.14e-41 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148563
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.6%
Validation Efficiency 96% (64/67)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele are viable, fertile and phenotypically normal under standard conditions but show increased mortality in response to diet-induced acute pancreatitis along with hepatic cell necrosis and inflammatory infiltration, andincreased plasma amylase and lipase levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700016H13Rik A T 5: 103,649,490 V51E probably benign Het
4922502D21Rik T C 6: 129,326,850 probably benign Het
Abo T C 2: 26,843,416 Y259C probably damaging Het
Adamts5 A G 16: 85,877,906 S457P probably damaging Het
Alk G T 17: 71,899,286 probably benign Het
Alpk2 A G 18: 65,306,159 I1188T probably benign Het
Ambra1 T C 2: 91,875,739 S730P possibly damaging Het
Arhgef2 T C 3: 88,632,268 probably benign Het
B3gnt7 T C 1: 86,305,629 I82T probably damaging Het
B4galnt3 T C 6: 120,216,565 D400G probably benign Het
Bag4 A G 8: 25,767,997 V434A possibly damaging Het
BC055324 T C 1: 163,968,321 I434V probably benign Het
Cfc1 A G 1: 34,537,328 D130G probably damaging Het
Chd4 T C 6: 125,107,480 Y692H probably damaging Het
Cilp2 A G 8: 69,882,993 S452P probably benign Het
Crybg2 GAGAAGAAG GAGAAG 4: 134,072,636 probably benign Het
Dnah2 T C 11: 69,499,238 D727G probably benign Het
Dock10 C A 1: 80,535,933 V1129F possibly damaging Het
Dsc1 A T 18: 20,088,354 I688N possibly damaging Het
Dyrk1a C G 16: 94,663,842 T103R probably damaging Het
Ebf1 C T 11: 44,924,470 R304* probably null Het
Eif2s2 A G 2: 154,884,461 probably benign Het
Endov T G 11: 119,499,571 Y8* probably null Het
Eps15 T A 4: 109,366,480 D485E probably damaging Het
Fam118a C A 15: 85,045,689 S39R probably damaging Het
Fam173b T A 15: 31,617,002 Y126* probably null Het
Fbxo22 T A 9: 55,223,626 M393K possibly damaging Het
Gab1 A G 8: 80,800,289 I60T probably damaging Het
Gapvd1 A G 2: 34,693,427 L1059P probably benign Het
Gbp5 A G 3: 142,507,913 probably null Het
Glb1l2 T A 9: 26,765,104 K487* probably null Het
Hist1h1a A G 13: 23,764,158 probably benign Het
Hmcn1 T C 1: 150,715,822 I1875M possibly damaging Het
Jkamp T C 12: 72,094,145 probably null Het
Kprp C T 3: 92,825,713 C10Y probably damaging Het
Lrig2 A G 3: 104,494,056 probably null Het
Lrrn3 T A 12: 41,453,940 N126I probably damaging Het
Myadm AC ACC 7: 3,296,760 probably null Het
Nagk C T 6: 83,797,267 R87* probably null Het
Nipal4 T A 11: 46,161,908 I77F probably damaging Het
Olfr1217 A G 2: 89,023,146 Y286H probably damaging Het
Osbp2 T C 11: 3,819,932 H250R probably damaging Het
Pcx T C 19: 4,607,642 V378A possibly damaging Het
Pfkp T A 13: 6,593,210 H524L probably benign Het
Picalm A T 7: 90,189,198 N370I possibly damaging Het
Plcl2 A C 17: 50,607,955 D664A possibly damaging Het
Ptpn5 G A 7: 47,083,136 P320S probably benign Het
Scn3a T A 2: 65,525,982 probably benign Het
Sfswap A G 5: 129,504,051 D96G possibly damaging Het
Slfn1 A G 11: 83,121,270 I71V probably benign Het
Spata1 A G 3: 146,476,188 probably null Het
Stx18 T C 5: 38,105,005 probably benign Het
Suox T A 10: 128,671,457 H234L probably benign Het
Tbc1d17 T C 7: 44,846,059 S114G probably benign Het
Tfeb T A 17: 47,788,299 probably null Het
Tnks A C 8: 34,853,309 V736G probably damaging Het
Wdhd1 T C 14: 47,276,588 T4A probably benign Het
Wdr66 A G 5: 123,287,413 probably null Het
Other mutations in Mug1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00158:Mug1 APN 6 121865809 missense probably damaging 1.00
IGL00485:Mug1 APN 6 121887416 missense probably benign 0.17
IGL00816:Mug1 APN 6 121882638 missense probably damaging 0.99
IGL01140:Mug1 APN 6 121882734 missense probably benign 0.01
IGL01141:Mug1 APN 6 121870499 missense probably benign 0.08
IGL01384:Mug1 APN 6 121849474 splice site probably benign
IGL01659:Mug1 APN 6 121870660 splice site probably benign
IGL02049:Mug1 APN 6 121871336 missense probably benign
IGL02151:Mug1 APN 6 121884690 critical splice donor site probably null
IGL02315:Mug1 APN 6 121840167 missense probably benign
IGL02629:Mug1 APN 6 121840065 missense possibly damaging 0.62
IGL02642:Mug1 APN 6 121882585 missense probably benign 0.14
IGL02807:Mug1 APN 6 121886572 missense probably damaging 0.96
IGL02932:Mug1 APN 6 121887427 missense probably benign 0.35
IGL03232:Mug1 APN 6 121878535 missense probably benign 0.00
R1462_Mug1_304 UTSW 6 121882629 missense probably benign 0.41
R2341_Mug1_749 UTSW 6 121884629 missense probably benign 0.06
R4261_Mug1_652 UTSW 6 121873734 missense probably benign
R6173_mug1_139 UTSW 6 121863793 missense probably damaging 0.99
IGL03050:Mug1 UTSW 6 121880571 missense possibly damaging 0.90
R0101:Mug1 UTSW 6 121884247 missense possibly damaging 0.59
R0194:Mug1 UTSW 6 121840107 missense probably damaging 0.98
R0196:Mug1 UTSW 6 121838725 critical splice donor site probably null
R0325:Mug1 UTSW 6 121849842 missense probably benign
R0332:Mug1 UTSW 6 121849897 splice site probably null
R0377:Mug1 UTSW 6 121857361 missense probably benign 0.02
R0393:Mug1 UTSW 6 121849850 missense possibly damaging 0.64
R0457:Mug1 UTSW 6 121861555 missense probably benign 0.06
R0479:Mug1 UTSW 6 121840227 missense probably benign
R0519:Mug1 UTSW 6 121851424 missense possibly damaging 0.83
R0535:Mug1 UTSW 6 121851454 missense probably benign
R0745:Mug1 UTSW 6 121887427 missense probably benign 0.35
R0939:Mug1 UTSW 6 121884349 missense possibly damaging 0.95
R0975:Mug1 UTSW 6 121878539 missense probably damaging 0.99
R1033:Mug1 UTSW 6 121880551 missense probably damaging 0.99
R1086:Mug1 UTSW 6 121885854 missense probably damaging 1.00
R1116:Mug1 UTSW 6 121870645 missense probably benign
R1131:Mug1 UTSW 6 121861185 missense probably benign 0.18
R1249:Mug1 UTSW 6 121849461 missense probably benign 0.07
R1364:Mug1 UTSW 6 121881713 missense probably damaging 1.00
R1418:Mug1 UTSW 6 121838676 missense probably benign 0.00
R1462:Mug1 UTSW 6 121882629 missense probably benign 0.41
R1462:Mug1 UTSW 6 121882629 missense probably benign 0.41
R1494:Mug1 UTSW 6 121879300 missense probably damaging 1.00
R1639:Mug1 UTSW 6 121880571 missense probably damaging 1.00
R1901:Mug1 UTSW 6 121881821 missense probably benign
R1902:Mug1 UTSW 6 121881821 missense probably benign
R2087:Mug1 UTSW 6 121856291 missense probably benign 0.00
R2168:Mug1 UTSW 6 121870499 missense probably benign 0.08
R2249:Mug1 UTSW 6 121870510 missense probably benign
R2341:Mug1 UTSW 6 121884629 missense probably benign 0.06
R2888:Mug1 UTSW 6 121881843 missense probably benign 0.44
R2892:Mug1 UTSW 6 121840070 missense possibly damaging 0.91
R3703:Mug1 UTSW 6 121888556 splice site probably benign
R3789:Mug1 UTSW 6 121884628 missense probably benign 0.03
R3790:Mug1 UTSW 6 121884628 missense probably benign 0.03
R3950:Mug1 UTSW 6 121878530 missense probably damaging 1.00
R4261:Mug1 UTSW 6 121873734 missense probably benign
R4402:Mug1 UTSW 6 121879352 missense probably damaging 1.00
R4589:Mug1 UTSW 6 121857351 missense probably benign 0.19
R4707:Mug1 UTSW 6 121884641 missense probably damaging 1.00
R4766:Mug1 UTSW 6 121884254 missense probably benign 0.01
R4840:Mug1 UTSW 6 121885854 missense probably damaging 1.00
R4984:Mug1 UTSW 6 121838617 utr 5 prime probably benign
R4999:Mug1 UTSW 6 121878943 nonsense probably null
R5198:Mug1 UTSW 6 121874562 missense probably damaging 1.00
R5220:Mug1 UTSW 6 121861133 missense probably benign 0.03
R5253:Mug1 UTSW 6 121888913 missense probably benign 0.03
R5273:Mug1 UTSW 6 121873789 missense probably damaging 0.99
R5285:Mug1 UTSW 6 121841107 missense probably benign 0.45
R5387:Mug1 UTSW 6 121884394 missense probably damaging 0.99
R5560:Mug1 UTSW 6 121861073 missense probably damaging 0.96
R5652:Mug1 UTSW 6 121840181 missense probably benign
R5704:Mug1 UTSW 6 121851433 missense possibly damaging 0.63
R5732:Mug1 UTSW 6 121878493 missense probably benign 0.00
R6053:Mug1 UTSW 6 121865738 missense probably benign 0.00
R6173:Mug1 UTSW 6 121863793 missense probably damaging 0.99
R6578:Mug1 UTSW 6 121887452 missense probably benign 0.00
R6647:Mug1 UTSW 6 121840241 missense probably benign 0.02
R6681:Mug1 UTSW 6 121838724 missense possibly damaging 0.75
R6925:Mug1 UTSW 6 121881787 missense probably damaging 1.00
R7014:Mug1 UTSW 6 121861125 missense probably benign 0.22
R7031:Mug1 UTSW 6 121838714 missense probably benign 0.00
R7034:Mug1 UTSW 6 121873644 missense probably benign 0.00
R7156:Mug1 UTSW 6 121880905 missense probably damaging 1.00
R7156:Mug1 UTSW 6 121884343 missense probably damaging 1.00
R7179:Mug1 UTSW 6 121857420 missense probably benign 0.00
R7211:Mug1 UTSW 6 121880539 missense possibly damaging 0.52
R7318:Mug1 UTSW 6 121870652 critical splice donor site probably null
R7462:Mug1 UTSW 6 121875440 missense probably benign 0.00
R7479:Mug1 UTSW 6 121878508 missense possibly damaging 0.83
R7588:Mug1 UTSW 6 121875517 missense probably damaging 1.00
R7611:Mug1 UTSW 6 121875428 critical splice acceptor site probably null
R7659:Mug1 UTSW 6 121861220 missense possibly damaging 0.95
R7660:Mug1 UTSW 6 121861220 missense possibly damaging 0.95
R7661:Mug1 UTSW 6 121861220 missense possibly damaging 0.95
R7663:Mug1 UTSW 6 121861220 missense possibly damaging 0.95
R7664:Mug1 UTSW 6 121861220 missense possibly damaging 0.95
R7666:Mug1 UTSW 6 121861220 missense possibly damaging 0.95
R7788:Mug1 UTSW 6 121861220 missense possibly damaging 0.95
R7789:Mug1 UTSW 6 121861220 missense possibly damaging 0.95
R7794:Mug1 UTSW 6 121856288 missense possibly damaging 0.93
R7809:Mug1 UTSW 6 121878985 missense possibly damaging 0.79
R7836:Mug1 UTSW 6 121870652 critical splice donor site probably null
R7867:Mug1 UTSW 6 121873634 missense probably benign
R7904:Mug1 UTSW 6 121851465 missense probably benign
R7937:Mug1 UTSW 6 121861169 missense probably benign 0.00
R7981:Mug1 UTSW 6 121881764 missense probably damaging 1.00
R7999:Mug1 UTSW 6 121880896 missense possibly damaging 0.90
R8070:Mug1 UTSW 6 121875879 missense probably benign 0.26
R8071:Mug1 UTSW 6 121873672 missense probably benign
R8151:Mug1 UTSW 6 121841158 missense probably benign 0.01
R8491:Mug1 UTSW 6 121882729 missense probably damaging 1.00
R8714:Mug1 UTSW 6 121882722 missense probably benign 0.01
R8734:Mug1 UTSW 6 121871381 missense probably benign 0.00
R8807:Mug1 UTSW 6 121874475 missense probably benign 0.27
R8931:Mug1 UTSW 6 121884337 missense probably benign
R8940:Mug1 UTSW 6 121881683 missense
RF017:Mug1 UTSW 6 121884574 missense probably damaging 1.00
X0064:Mug1 UTSW 6 121861215 missense possibly damaging 0.48
Z1176:Mug1 UTSW 6 121841294 missense probably benign 0.32
Z1176:Mug1 UTSW 6 121880493 missense probably damaging 1.00
Z1177:Mug1 UTSW 6 121863808 missense probably damaging 0.99
Z1177:Mug1 UTSW 6 121879299 critical splice acceptor site probably null
Z1177:Mug1 UTSW 6 121886568 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TGACAAGTGTGCCATGTTACCTTGC -3'
(R):5'- TGGTTTTGAAGTGCCACTCTACAGC -3'

Sequencing Primer
(F):5'- GCTTTTCCATGTGAATGCAACTG -3'
(R):5'- TGAAGTGCCACTCTACAGCTAAAC -3'
Posted On2013-05-23