Incidental Mutation 'R5265:Scg5'
ID 401630
Institutional Source Beutler Lab
Gene Symbol Scg5
Ensembl Gene ENSMUSG00000023236
Gene Name secretogranin V
Synonyms 7B2, Sgne-1, Sgne1
MMRRC Submission 042833-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.069) question?
Stock # R5265 (G1)
Quality Score 225
Status Validated
Chromosome 2
Chromosomal Location 113776362-113829121 bp(-) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) A to T at 113776865 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Stop codon at position 192 (L192*)
Ref Sequence ENSEMBL: ENSMUSP00000024005 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024005]
AlphaFold P12961
Predicted Effect probably null
Transcript: ENSMUST00000024005
AA Change: L192*
SMART Domains Protein: ENSMUSP00000024005
Gene: ENSMUSG00000023236
AA Change: L192*

DomainStartEndE-ValueType
Pfam:Secretogranin_V 23 160 4e-13 PFAM
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.7%
Validation Efficiency 100% (59/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a secreted chaperone protein that prevents the aggregation of other secreted proteins, including proteins that are associated with neurodegenerative and metabolic disease. The encoded protein may be best known for its role in the trafficking and activation of prohormone convertase PC2 (encoded by Gene ID: 5126). Phosphorylation of the encoded protein has been shown to have an inhibitory effect on its chaperone function. [provided by RefSeq, Jul 2016]
PHENOTYPE: Mice homozygous for disruptions in this gene often die before weaning and display a variety of metabolic defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017B05Rik A G 9: 57,258,894 W66R probably damaging Het
Adamts3 A G 5: 89,861,552 V84A possibly damaging Het
Caap1 C A 4: 94,501,228 E290* probably null Het
Cant1 G A 11: 118,408,050 R296C probably damaging Het
Ccdc114 T A 7: 45,947,435 D395E probably damaging Het
Cdh5 A T 8: 104,142,739 H699L probably benign Het
Cfdp1 T C 8: 111,830,985 T175A probably benign Het
Col4a4 C T 1: 82,493,591 G681E unknown Het
Comtd1 G A 14: 21,848,793 T27I probably benign Het
Copg1 T A 6: 87,892,270 V155D probably damaging Het
Dag1 A G 9: 108,207,699 Y748H possibly damaging Het
Dmwd T A 7: 19,080,281 N285K possibly damaging Het
Dsp A G 13: 38,195,183 E1968G possibly damaging Het
Ednra A G 8: 77,667,375 I364T probably damaging Het
Elovl3 C A 19: 46,134,681 T232K probably damaging Het
Ercc3 T A 18: 32,254,243 I503N probably damaging Het
Ercc6 C A 14: 32,569,623 A1008D probably benign Het
Gm10563 TTTC TTTCATTC 4: 155,614,496 probably null Het
H2-DMb2 G T 17: 34,148,562 V117F probably damaging Het
Helt A T 8: 46,292,433 W138R probably damaging Het
Itga11 A T 9: 62,737,412 H215L probably benign Het
Kcnn1 T A 8: 70,854,653 I156F probably benign Het
Kdm1b A G 13: 47,062,969 N272D probably benign Het
Kdm2b T C 5: 122,878,588 T1161A probably damaging Het
Lin54 A G 5: 100,485,519 L102P probably damaging Het
Mlh1 A C 9: 111,271,523 M1R probably null Het
Naip2 G A 13: 100,152,560 L1165F probably damaging Het
Nfkbiz A G 16: 55,819,641 S118P probably damaging Het
Nkx3-2 T A 5: 41,761,848 M266L probably benign Het
Npr1 T C 3: 90,457,002 E771G probably benign Het
Obox8 C T 7: 14,332,029 R188H probably benign Het
Olfr187 A T 16: 59,036,143 V198D possibly damaging Het
Olfr497 T A 7: 108,423,402 V277E possibly damaging Het
Palm3 T C 8: 84,021,530 probably null Het
Palmd A T 3: 116,923,849 V333D possibly damaging Het
Pikfyve A G 1: 65,267,829 E1747G possibly damaging Het
Polr3a T C 14: 24,454,941 I1084V possibly damaging Het
Ranbp3l T A 15: 9,007,203 F127I probably benign Het
Rsl1d1 A G 16: 11,201,384 F97L possibly damaging Het
Scaper A G 9: 55,864,546 V362A probably benign Het
Slc34a2 T C 5: 53,061,434 I198T probably damaging Het
Slc45a3 T A 1: 131,978,194 D318E possibly damaging Het
Sorl1 A G 9: 42,106,516 M105T possibly damaging Het
St3gal5 T A 6: 72,149,131 I320N probably damaging Het
Stx17 A G 4: 48,183,470 probably benign Het
Syt5 C T 7: 4,541,075 probably null Het
Thrap3 A G 4: 126,167,640 S774P probably damaging Het
Tnc A T 4: 63,993,206 M1376K probably benign Het
Tnks1bp1 T A 2: 85,062,754 D1008E probably benign Het
Trav7-1 G T 14: 52,655,304 A105S probably damaging Het
Vmn1r28 T A 6: 58,265,964 V264D probably damaging Het
Vmn1r44 T C 6: 89,893,839 V46A probably benign Het
Vmn2r10 A G 5: 108,995,720 I788T probably damaging Het
Vmn2r78 T A 7: 86,920,124 I75N probably damaging Het
Zfp821 T C 8: 109,724,359 M328T probably damaging Het
Zfp995 G A 17: 21,880,623 P210L possibly damaging Het
Other mutations in Scg5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00236:Scg5 APN 2 113827570 unclassified probably benign
IGL02124:Scg5 APN 2 113792037 splice site probably benign
R3928:Scg5 UTSW 2 113791885 missense probably damaging 0.97
R6378:Scg5 UTSW 2 113827392 missense possibly damaging 0.74
Predicted Primers PCR Primer
(F):5'- AAGGACAGCTGCTTTTCATCC -3'
(R):5'- GACTGTGTACTGCGCTATGG -3'

Sequencing Primer
(F):5'- CAGCTGCTTTTCATCCATAAATATG -3'
(R):5'- GGTTCTCATGCAATGCCA -3'
Posted On 2016-07-06