Incidental Mutation 'R0414:Chd4'
ID40164
Institutional Source Beutler Lab
Gene Symbol Chd4
Ensembl Gene ENSMUSG00000063870
Gene Namechromodomain helicase DNA binding protein 4
SynonymsD6Ertd380e, Mi-2beta, 9530019N15Rik
MMRRC Submission 038616-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0414 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location125095981-125130591 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 125107480 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 692 (Y692H)
Ref Sequence ENSEMBL: ENSMUSP00000108011 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056889] [ENSMUST00000112390] [ENSMUST00000112392]
Predicted Effect probably damaging
Transcript: ENSMUST00000056889
AA Change: Y705H

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000060054
Gene: ENSMUSG00000063870
AA Change: Y705H

DomainStartEndE-ValueType
low complexity region 29 45 N/A INTRINSIC
low complexity region 49 69 N/A INTRINSIC
low complexity region 80 92 N/A INTRINSIC
low complexity region 107 144 N/A INTRINSIC
Pfam:CHDNT 156 210 7.7e-35 PFAM
low complexity region 217 249 N/A INTRINSIC
low complexity region 271 291 N/A INTRINSIC
low complexity region 296 318 N/A INTRINSIC
low complexity region 321 347 N/A INTRINSIC
PHD 365 408 7.17e-15 SMART
RING 366 407 7.46e-1 SMART
low complexity region 424 443 N/A INTRINSIC
PHD 444 487 4.41e-15 SMART
RING 445 486 2.63e0 SMART
CHROMO 492 572 8.11e-17 SMART
CHROMO 613 670 1.98e-11 SMART
low complexity region 675 694 N/A INTRINSIC
DEXDc 715 927 2.73e-37 SMART
low complexity region 1044 1056 N/A INTRINSIC
HELICc 1073 1157 7.61e-27 SMART
DUF1087 1282 1346 5.56e-33 SMART
DUF1086 1359 1516 4.05e-108 SMART
low complexity region 1526 1540 N/A INTRINSIC
low complexity region 1560 1578 N/A INTRINSIC
low complexity region 1590 1633 N/A INTRINSIC
low complexity region 1635 1653 N/A INTRINSIC
low complexity region 1661 1674 N/A INTRINSIC
Pfam:CHDCT2 1727 1899 1.9e-98 PFAM
low complexity region 1903 1915 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000112390
AA Change: Y712H

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000108009
Gene: ENSMUSG00000063870
AA Change: Y712H

DomainStartEndE-ValueType
low complexity region 29 45 N/A INTRINSIC
low complexity region 49 69 N/A INTRINSIC
low complexity region 87 99 N/A INTRINSIC
low complexity region 114 151 N/A INTRINSIC
Pfam:CHDNT 164 217 2e-28 PFAM
low complexity region 224 256 N/A INTRINSIC
low complexity region 278 298 N/A INTRINSIC
low complexity region 303 325 N/A INTRINSIC
low complexity region 328 354 N/A INTRINSIC
PHD 372 415 7.17e-15 SMART
RING 373 414 7.46e-1 SMART
low complexity region 431 450 N/A INTRINSIC
PHD 451 494 4.41e-15 SMART
RING 452 493 2.63e0 SMART
CHROMO 499 579 8.11e-17 SMART
CHROMO 620 677 1.98e-11 SMART
low complexity region 682 701 N/A INTRINSIC
DEXDc 722 934 2.73e-37 SMART
low complexity region 1051 1063 N/A INTRINSIC
HELICc 1080 1164 7.61e-27 SMART
DUF1087 1289 1353 5.56e-33 SMART
DUF1086 1366 1523 4.05e-108 SMART
low complexity region 1533 1547 N/A INTRINSIC
low complexity region 1567 1585 N/A INTRINSIC
low complexity region 1597 1640 N/A INTRINSIC
low complexity region 1642 1660 N/A INTRINSIC
low complexity region 1668 1681 N/A INTRINSIC
Pfam:CHDCT2 1735 1906 4.3e-90 PFAM
low complexity region 1910 1922 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000112392
AA Change: Y692H

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000108011
Gene: ENSMUSG00000063870
AA Change: Y692H

DomainStartEndE-ValueType
low complexity region 29 45 N/A INTRINSIC
low complexity region 49 69 N/A INTRINSIC
low complexity region 80 92 N/A INTRINSIC
low complexity region 107 144 N/A INTRINSIC
Pfam:CHDNT 156 210 1.1e-34 PFAM
low complexity region 217 249 N/A INTRINSIC
low complexity region 271 291 N/A INTRINSIC
low complexity region 296 318 N/A INTRINSIC
low complexity region 321 347 N/A INTRINSIC
PHD 352 395 7.17e-15 SMART
RING 353 394 7.46e-1 SMART
low complexity region 411 430 N/A INTRINSIC
PHD 431 474 4.41e-15 SMART
RING 432 473 2.63e0 SMART
CHROMO 479 559 8.11e-17 SMART
CHROMO 600 657 1.98e-11 SMART
low complexity region 662 681 N/A INTRINSIC
DEXDc 702 914 2.73e-37 SMART
low complexity region 1031 1043 N/A INTRINSIC
HELICc 1060 1144 7.61e-27 SMART
DUF1087 1269 1333 5.56e-33 SMART
DUF1086 1346 1503 4.05e-108 SMART
low complexity region 1513 1527 N/A INTRINSIC
low complexity region 1547 1565 N/A INTRINSIC
low complexity region 1577 1620 N/A INTRINSIC
low complexity region 1622 1640 N/A INTRINSIC
low complexity region 1648 1661 N/A INTRINSIC
Pfam:CHDCT2 1714 1886 2.8e-98 PFAM
low complexity region 1890 1902 N/A INTRINSIC
Meta Mutation Damage Score 0.232 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.6%
Validation Efficiency 96% (64/67)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene belongs to the SNF2/RAD54 helicase family. It represents the main component of the nucleosome remodeling and deacetylase complex and plays an important role in epigenetic transcriptional repression. Patients with dermatomyositis develop antibodies against this protein. Somatic mutations in this gene are associated with serous endometrial tumors. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2014]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit embryonic lethality between E3.5 and E4.5, absent blastocoele failure of trophectoderm function and increased apoptosis in blastocysts. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700016H13Rik A T 5: 103,649,490 V51E probably benign Het
4922502D21Rik T C 6: 129,326,850 probably benign Het
Abo T C 2: 26,843,416 Y259C probably damaging Het
Adamts5 A G 16: 85,877,906 S457P probably damaging Het
Alk G T 17: 71,899,286 probably benign Het
Alpk2 A G 18: 65,306,159 I1188T probably benign Het
Ambra1 T C 2: 91,875,739 S730P possibly damaging Het
Arhgef2 T C 3: 88,632,268 probably benign Het
B3gnt7 T C 1: 86,305,629 I82T probably damaging Het
B4galnt3 T C 6: 120,216,565 D400G probably benign Het
Bag4 A G 8: 25,767,997 V434A possibly damaging Het
BC055324 T C 1: 163,968,321 I434V probably benign Het
Cfc1 A G 1: 34,537,328 D130G probably damaging Het
Cilp2 A G 8: 69,882,993 S452P probably benign Het
Crybg2 GAGAAGAAG GAGAAG 4: 134,072,636 probably benign Het
Dnah2 T C 11: 69,499,238 D727G probably benign Het
Dock10 C A 1: 80,535,933 V1129F possibly damaging Het
Dsc1 A T 18: 20,088,354 I688N possibly damaging Het
Dyrk1a C G 16: 94,663,842 T103R probably damaging Het
Ebf1 C T 11: 44,924,470 R304* probably null Het
Eif2s2 A G 2: 154,884,461 probably benign Het
Endov T G 11: 119,499,571 Y8* probably null Het
Eps15 T A 4: 109,366,480 D485E probably damaging Het
Fam118a C A 15: 85,045,689 S39R probably damaging Het
Fam173b T A 15: 31,617,002 Y126* probably null Het
Fbxo22 T A 9: 55,223,626 M393K possibly damaging Het
Gab1 A G 8: 80,800,289 I60T probably damaging Het
Gapvd1 A G 2: 34,693,427 L1059P probably benign Het
Gbp5 A G 3: 142,507,913 probably null Het
Glb1l2 T A 9: 26,765,104 K487* probably null Het
Hist1h1a A G 13: 23,764,158 probably benign Het
Hmcn1 T C 1: 150,715,822 I1875M possibly damaging Het
Jkamp T C 12: 72,094,145 probably null Het
Kprp C T 3: 92,825,713 C10Y probably damaging Het
Lrig2 A G 3: 104,494,056 probably null Het
Lrrn3 T A 12: 41,453,940 N126I probably damaging Het
Mug1 T C 6: 121,856,554 F325L probably benign Het
Myadm AC ACC 7: 3,296,760 probably null Het
Nagk C T 6: 83,797,267 R87* probably null Het
Nipal4 T A 11: 46,161,908 I77F probably damaging Het
Olfr1217 A G 2: 89,023,146 Y286H probably damaging Het
Osbp2 T C 11: 3,819,932 H250R probably damaging Het
Pcx T C 19: 4,607,642 V378A possibly damaging Het
Pfkp T A 13: 6,593,210 H524L probably benign Het
Picalm A T 7: 90,189,198 N370I possibly damaging Het
Plcl2 A C 17: 50,607,955 D664A possibly damaging Het
Ptpn5 G A 7: 47,083,136 P320S probably benign Het
Scn3a T A 2: 65,525,982 probably benign Het
Sfswap A G 5: 129,504,051 D96G possibly damaging Het
Slfn1 A G 11: 83,121,270 I71V probably benign Het
Spata1 A G 3: 146,476,188 probably null Het
Stx18 T C 5: 38,105,005 probably benign Het
Suox T A 10: 128,671,457 H234L probably benign Het
Tbc1d17 T C 7: 44,846,059 S114G probably benign Het
Tfeb T A 17: 47,788,299 probably null Het
Tnks A C 8: 34,853,309 V736G probably damaging Het
Wdhd1 T C 14: 47,276,588 T4A probably benign Het
Wdr66 A G 5: 123,287,413 probably null Het
Other mutations in Chd4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00573:Chd4 APN 6 125109897 missense probably damaging 1.00
IGL00917:Chd4 APN 6 125104946 missense possibly damaging 0.95
IGL01088:Chd4 APN 6 125122468 unclassified probably benign
IGL02005:Chd4 APN 6 125128816 missense possibly damaging 0.71
IGL02405:Chd4 APN 6 125097227 missense probably benign 0.06
IGL02707:Chd4 APN 6 125108767 missense probably damaging 1.00
IGL02976:Chd4 APN 6 125121368 missense probably damaging 1.00
IGL03001:Chd4 APN 6 125101566 missense possibly damaging 0.93
FR4304:Chd4 UTSW 6 125122144 unclassified probably benign
FR4589:Chd4 UTSW 6 125122133 missense probably benign 0.02
FR4589:Chd4 UTSW 6 125122139 unclassified probably benign
FR4737:Chd4 UTSW 6 125122131 unclassified probably benign
FR4976:Chd4 UTSW 6 125122131 unclassified probably benign
R0311:Chd4 UTSW 6 125101665 missense probably benign 0.15
R0647:Chd4 UTSW 6 125109123 missense probably damaging 1.00
R0656:Chd4 UTSW 6 125102967 missense probably damaging 0.98
R1342:Chd4 UTSW 6 125097188 missense probably benign 0.40
R1651:Chd4 UTSW 6 125123584 missense possibly damaging 0.92
R1850:Chd4 UTSW 6 125121656 missense probably damaging 1.00
R2190:Chd4 UTSW 6 125114297 missense probably benign 0.18
R2192:Chd4 UTSW 6 125105357 missense probably damaging 0.99
R2858:Chd4 UTSW 6 125104886 missense probably damaging 0.99
R3406:Chd4 UTSW 6 125122007 missense probably benign 0.09
R3431:Chd4 UTSW 6 125120560 splice site probably benign
R4330:Chd4 UTSW 6 125101602 missense probably benign 0.29
R4394:Chd4 UTSW 6 125121618 missense probably damaging 0.99
R4538:Chd4 UTSW 6 125120686 missense probably damaging 0.99
R4664:Chd4 UTSW 6 125101502 missense possibly damaging 0.58
R4805:Chd4 UTSW 6 125128945 missense possibly damaging 0.86
R5050:Chd4 UTSW 6 125107480 missense probably damaging 1.00
R5055:Chd4 UTSW 6 125100986 missense possibly damaging 0.65
R5232:Chd4 UTSW 6 125121310 missense probably damaging 1.00
R5314:Chd4 UTSW 6 125100588 missense probably damaging 0.96
R5343:Chd4 UTSW 6 125120363 missense probably damaging 1.00
R5502:Chd4 UTSW 6 125105276 missense possibly damaging 0.83
R5613:Chd4 UTSW 6 125120546 missense probably damaging 0.99
R6211:Chd4 UTSW 6 125101285 missense possibly damaging 0.82
R6606:Chd4 UTSW 6 125109426 missense probably damaging 0.99
R6753:Chd4 UTSW 6 125114300 missense probably benign 0.01
R6808:Chd4 UTSW 6 125122123 missense possibly damaging 0.53
R6939:Chd4 UTSW 6 125106538 missense probably damaging 0.99
R6968:Chd4 UTSW 6 125108318 missense probably damaging 1.00
R6973:Chd4 UTSW 6 125122862 missense possibly damaging 0.53
R6992:Chd4 UTSW 6 125114376 missense probably benign 0.14
R7058:Chd4 UTSW 6 125108442 missense possibly damaging 0.74
R7081:Chd4 UTSW 6 125129985 missense unknown
R7253:Chd4 UTSW 6 125106592 intron probably null
R7423:Chd4 UTSW 6 125128859 missense possibly damaging 0.92
R7535:Chd4 UTSW 6 125128873 missense probably benign 0.32
R7566:Chd4 UTSW 6 125101903 missense possibly damaging 0.86
X0025:Chd4 UTSW 6 125106467 nonsense probably null
X0027:Chd4 UTSW 6 125102164 missense probably damaging 0.98
X0063:Chd4 UTSW 6 125114015 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTATTGAGGGTCACACAGGTCCAC -3'
(R):5'- TGCTGTCTGCACAGTTTTCCCAAG -3'

Sequencing Primer
(F):5'- tcaatccttctgtctcagcc -3'
(R):5'- ACAGTTTTCCCAAGGCCCATC -3'
Posted On2013-05-23