Mutagenetix > Incidental Mutations

Incidental Mutation 'R0414:Chd4'

40164

Institutional Source

Beutler Lab

Gene Symbol

Chd4

Ensembl Gene

ENSMUSG00000063870

Gene Name

chromodomain helicase DNA binding protein 4

Synonyms

D6Ertd380e, Mi-2beta, 9530019N15Rik

MMRRC Submission

038616-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R0414 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

125095981-125130591 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 125107480 bp

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Histidine at position 692 (Y692H)

Ref Sequence

ENSEMBL: ENSMUSP00000108011 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000056889] [ENSMUST00000112390] [ENSMUST00000112392]

Predicted Effect

probably damaging
Transcript: ENSMUST00000056889
AA Change: Y705H

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000060054
Gene: ENSMUSG00000063870
AA Change: Y705H

Domain	Start	End	E-Value	Type
low complexity region	29	45	N/A	INTRINSIC
low complexity region	49	69	N/A	INTRINSIC
low complexity region	80	92	N/A	INTRINSIC
low complexity region	107	144	N/A	INTRINSIC
Pfam:CHDNT	156	210	7.7e-35	PFAM
low complexity region	217	249	N/A	INTRINSIC
low complexity region	271	291	N/A	INTRINSIC
low complexity region	296	318	N/A	INTRINSIC
low complexity region	321	347	N/A	INTRINSIC
PHD	365	408	7.17e-15	SMART
RING	366	407	7.46e-1	SMART
low complexity region	424	443	N/A	INTRINSIC
PHD	444	487	4.41e-15	SMART
RING	445	486	2.63e0	SMART
CHROMO	492	572	8.11e-17	SMART
CHROMO	613	670	1.98e-11	SMART
low complexity region	675	694	N/A	INTRINSIC
DEXDc	715	927	2.73e-37	SMART
low complexity region	1044	1056	N/A	INTRINSIC
HELICc	1073	1157	7.61e-27	SMART
DUF1087	1282	1346	5.56e-33	SMART
DUF1086	1359	1516	4.05e-108	SMART
low complexity region	1526	1540	N/A	INTRINSIC
low complexity region	1560	1578	N/A	INTRINSIC
low complexity region	1590	1633	N/A	INTRINSIC
low complexity region	1635	1653	N/A	INTRINSIC
low complexity region	1661	1674	N/A	INTRINSIC
Pfam:CHDCT2	1727	1899	1.9e-98	PFAM
low complexity region	1903	1915	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000112390
AA Change: Y712H

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000108009
Gene: ENSMUSG00000063870
AA Change: Y712H

Domain	Start	End	E-Value	Type
low complexity region	29	45	N/A	INTRINSIC
low complexity region	49	69	N/A	INTRINSIC
low complexity region	87	99	N/A	INTRINSIC
low complexity region	114	151	N/A	INTRINSIC
Pfam:CHDNT	164	217	2e-28	PFAM
low complexity region	224	256	N/A	INTRINSIC
low complexity region	278	298	N/A	INTRINSIC
low complexity region	303	325	N/A	INTRINSIC
low complexity region	328	354	N/A	INTRINSIC
PHD	372	415	7.17e-15	SMART
RING	373	414	7.46e-1	SMART
low complexity region	431	450	N/A	INTRINSIC
PHD	451	494	4.41e-15	SMART
RING	452	493	2.63e0	SMART
CHROMO	499	579	8.11e-17	SMART
CHROMO	620	677	1.98e-11	SMART
low complexity region	682	701	N/A	INTRINSIC
DEXDc	722	934	2.73e-37	SMART
low complexity region	1051	1063	N/A	INTRINSIC
HELICc	1080	1164	7.61e-27	SMART
DUF1087	1289	1353	5.56e-33	SMART
DUF1086	1366	1523	4.05e-108	SMART
low complexity region	1533	1547	N/A	INTRINSIC
low complexity region	1567	1585	N/A	INTRINSIC
low complexity region	1597	1640	N/A	INTRINSIC
low complexity region	1642	1660	N/A	INTRINSIC
low complexity region	1668	1681	N/A	INTRINSIC
Pfam:CHDCT2	1735	1906	4.3e-90	PFAM
low complexity region	1910	1922	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000112392
AA Change: Y692H

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000108011
Gene: ENSMUSG00000063870
AA Change: Y692H

Domain	Start	End	E-Value	Type
low complexity region	29	45	N/A	INTRINSIC
low complexity region	49	69	N/A	INTRINSIC
low complexity region	80	92	N/A	INTRINSIC
low complexity region	107	144	N/A	INTRINSIC
Pfam:CHDNT	156	210	1.1e-34	PFAM
low complexity region	217	249	N/A	INTRINSIC
low complexity region	271	291	N/A	INTRINSIC
low complexity region	296	318	N/A	INTRINSIC
low complexity region	321	347	N/A	INTRINSIC
PHD	352	395	7.17e-15	SMART
RING	353	394	7.46e-1	SMART
low complexity region	411	430	N/A	INTRINSIC
PHD	431	474	4.41e-15	SMART
RING	432	473	2.63e0	SMART
CHROMO	479	559	8.11e-17	SMART
CHROMO	600	657	1.98e-11	SMART
low complexity region	662	681	N/A	INTRINSIC
DEXDc	702	914	2.73e-37	SMART
low complexity region	1031	1043	N/A	INTRINSIC
HELICc	1060	1144	7.61e-27	SMART
DUF1087	1269	1333	5.56e-33	SMART
DUF1086	1346	1503	4.05e-108	SMART
low complexity region	1513	1527	N/A	INTRINSIC
low complexity region	1547	1565	N/A	INTRINSIC
low complexity region	1577	1620	N/A	INTRINSIC
low complexity region	1622	1640	N/A	INTRINSIC
low complexity region	1648	1661	N/A	INTRINSIC
Pfam:CHDCT2	1714	1886	2.8e-98	PFAM
low complexity region	1890	1902	N/A	INTRINSIC

Meta Mutation Damage Score

0.2000

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.6%
20x: 93.6%

Validation Efficiency

96% (64/67)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene belongs to the SNF2/RAD54 helicase family. It represents the main component of the nucleosome remodeling and deacetylase complex and plays an important role in epigenetic transcriptional repression. Patients with dermatomyositis develop antibodies against this protein. Somatic mutations in this gene are associated with serous endometrial tumors. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2014]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit embryonic lethality between E3.5 and E4.5, absent blastocoele failure of trophectoderm function and increased apoptosis in blastocysts. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 58 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700016H13Rik	A	T	5: 103,649,490	V51E	probably benign	Het
4922502D21Rik	T	C	6: 129,326,850		probably benign	Het
Abo	T	C	2: 26,843,416	Y259C	probably damaging	Het
Adamts5	A	G	16: 85,877,906	S457P	probably damaging	Het
Alk	G	T	17: 71,899,286		probably benign	Het
Alpk2	A	G	18: 65,306,159	I1188T	probably benign	Het
Ambra1	T	C	2: 91,875,739	S730P	possibly damaging	Het
Arhgef2	T	C	3: 88,632,268		probably benign	Het
B3gnt7	T	C	1: 86,305,629	I82T	probably damaging	Het
B4galnt3	T	C	6: 120,216,565	D400G	probably benign	Het
Bag4	A	G	8: 25,767,997	V434A	possibly damaging	Het
BC055324	T	C	1: 163,968,321	I434V	probably benign	Het
Cfc1	A	G	1: 34,537,328	D130G	probably damaging	Het
Cilp2	A	G	8: 69,882,993	S452P	probably benign	Het
Crybg2	GAGAAGAAG	GAGAAG	4: 134,072,636		probably benign	Het
Dnah2	T	C	11: 69,499,238	D727G	probably benign	Het
Dock10	C	A	1: 80,535,933	V1129F	possibly damaging	Het
Dsc1	A	T	18: 20,088,354	I688N	possibly damaging	Het
Dyrk1a	C	G	16: 94,663,842	T103R	probably damaging	Het
Ebf1	C	T	11: 44,924,470	R304*	probably null	Het
Eif2s2	A	G	2: 154,884,461		probably benign	Het
Endov	T	G	11: 119,499,571	Y8*	probably null	Het
Eps15	T	A	4: 109,366,480	D485E	probably damaging	Het
Fam118a	C	A	15: 85,045,689	S39R	probably damaging	Het
Fam173b	T	A	15: 31,617,002	Y126*	probably null	Het
Fbxo22	T	A	9: 55,223,626	M393K	possibly damaging	Het
Gab1	A	G	8: 80,800,289	I60T	probably damaging	Het
Gapvd1	A	G	2: 34,693,427	L1059P	probably benign	Het
Gbp5	A	G	3: 142,507,913		probably null	Het
Glb1l2	T	A	9: 26,765,104	K487*	probably null	Het
Hist1h1a	A	G	13: 23,764,158		probably benign	Het
Hmcn1	T	C	1: 150,715,822	I1875M	possibly damaging	Het
Jkamp	T	C	12: 72,094,145		probably null	Het
Kprp	C	T	3: 92,825,713	C10Y	probably damaging	Het
Lrig2	A	G	3: 104,494,056		probably null	Het
Lrrn3	T	A	12: 41,453,940	N126I	probably damaging	Het
Mug1	T	C	6: 121,856,554	F325L	probably benign	Het
Myadm	AC	ACC	7: 3,296,760		probably null	Het
Nagk	C	T	6: 83,797,267	R87*	probably null	Het
Nipal4	T	A	11: 46,161,908	I77F	probably damaging	Het
Olfr1217	A	G	2: 89,023,146	Y286H	probably damaging	Het
Osbp2	T	C	11: 3,819,932	H250R	probably damaging	Het
Pcx	T	C	19: 4,607,642	V378A	possibly damaging	Het
Pfkp	T	A	13: 6,593,210	H524L	probably benign	Het
Picalm	A	T	7: 90,189,198	N370I	possibly damaging	Het
Plcl2	A	C	17: 50,607,955	D664A	possibly damaging	Het
Ptpn5	G	A	7: 47,083,136	P320S	probably benign	Het
Scn3a	T	A	2: 65,525,982		probably benign	Het
Sfswap	A	G	5: 129,504,051	D96G	possibly damaging	Het
Slfn1	A	G	11: 83,121,270	I71V	probably benign	Het
Spata1	A	G	3: 146,476,188		probably null	Het
Stx18	T	C	5: 38,105,005		probably benign	Het
Suox	T	A	10: 128,671,457	H234L	probably benign	Het
Tbc1d17	T	C	7: 44,846,059	S114G	probably benign	Het
Tfeb	T	A	17: 47,788,299		probably null	Het
Tnks	A	C	8: 34,853,309	V736G	probably damaging	Het
Wdhd1	T	C	14: 47,276,588	T4A	probably benign	Het
Wdr66	A	G	5: 123,287,413		probably null	Het

Other mutations in Chd4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00573:Chd4	APN	6	125109897	missense	probably damaging	1.00
IGL00917:Chd4	APN	6	125104946	missense	possibly damaging	0.95
IGL01088:Chd4	APN	6	125122468	unclassified	probably benign
IGL02005:Chd4	APN	6	125128816	missense	possibly damaging	0.71
IGL02405:Chd4	APN	6	125097227	missense	probably benign	0.06
IGL02707:Chd4	APN	6	125108767	missense	probably damaging	1.00
IGL02976:Chd4	APN	6	125121368	missense	probably damaging	1.00
IGL03001:Chd4	APN	6	125101566	missense	possibly damaging	0.93
FR4304:Chd4	UTSW	6	125122144	unclassified	probably benign
FR4589:Chd4	UTSW	6	125122133	missense	probably benign	0.02
FR4589:Chd4	UTSW	6	125122139	unclassified	probably benign
FR4737:Chd4	UTSW	6	125122131	unclassified	probably benign
FR4976:Chd4	UTSW	6	125122131	unclassified	probably benign
R0311:Chd4	UTSW	6	125101665	missense	probably benign	0.15
R0647:Chd4	UTSW	6	125109123	missense	probably damaging	1.00
R0656:Chd4	UTSW	6	125102967	missense	probably damaging	0.98
R1342:Chd4	UTSW	6	125097188	missense	probably benign	0.40
R1651:Chd4	UTSW	6	125123584	missense	possibly damaging	0.92
R1850:Chd4	UTSW	6	125121656	missense	probably damaging	1.00
R2190:Chd4	UTSW	6	125114297	missense	probably benign	0.18
R2192:Chd4	UTSW	6	125105357	missense	probably damaging	0.99
R2858:Chd4	UTSW	6	125104886	missense	probably damaging	0.99
R3406:Chd4	UTSW	6	125122007	missense	probably benign	0.09
R3431:Chd4	UTSW	6	125120560	splice site	probably benign
R4330:Chd4	UTSW	6	125101602	missense	probably benign	0.29
R4394:Chd4	UTSW	6	125121618	missense	probably damaging	0.99
R4538:Chd4	UTSW	6	125120686	missense	probably damaging	0.99
R4664:Chd4	UTSW	6	125101502	missense	possibly damaging	0.58
R4805:Chd4	UTSW	6	125128945	missense	possibly damaging	0.86
R5050:Chd4	UTSW	6	125107480	missense	probably damaging	1.00
R5055:Chd4	UTSW	6	125100986	missense	possibly damaging	0.65
R5232:Chd4	UTSW	6	125121310	missense	probably damaging	1.00
R5314:Chd4	UTSW	6	125100588	missense	probably damaging	0.96
R5343:Chd4	UTSW	6	125120363	missense	probably damaging	1.00
R5502:Chd4	UTSW	6	125105276	missense	possibly damaging	0.83
R5613:Chd4	UTSW	6	125120546	missense	probably damaging	0.99
R6211:Chd4	UTSW	6	125101285	missense	possibly damaging	0.82
R6606:Chd4	UTSW	6	125109426	missense	probably damaging	0.99
R6753:Chd4	UTSW	6	125114300	missense	probably benign	0.01
R6808:Chd4	UTSW	6	125122123	missense	possibly damaging	0.53
R6939:Chd4	UTSW	6	125106538	missense	probably damaging	0.99
R6968:Chd4	UTSW	6	125108318	missense	probably damaging	1.00
R6973:Chd4	UTSW	6	125122862	missense	possibly damaging	0.53
R6992:Chd4	UTSW	6	125114376	missense	probably benign	0.14
R7058:Chd4	UTSW	6	125108442	missense	possibly damaging	0.74
R7081:Chd4	UTSW	6	125129985	missense	unknown
R7253:Chd4	UTSW	6	125106592	intron	probably null
R7423:Chd4	UTSW	6	125128859	missense	possibly damaging	0.92
R7535:Chd4	UTSW	6	125128873	missense	probably benign	0.32
R7566:Chd4	UTSW	6	125101903	missense	possibly damaging	0.86
RF046:Chd4	UTSW	6	125122131	unclassified	probably benign
RF052:Chd4	UTSW	6	125122145	unclassified	probably benign
RF058:Chd4	UTSW	6	125122131	unclassified	probably benign
RF060:Chd4	UTSW	6	125122145	unclassified	probably benign
X0025:Chd4	UTSW	6	125106467	nonsense	probably null
X0027:Chd4	UTSW	6	125102164	missense	probably damaging	0.98
X0063:Chd4	UTSW	6	125114015	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGTATTGAGGGTCACACAGGTCCAC -3'
(R):5'- TGCTGTCTGCACAGTTTTCCCAAG -3'

Sequencing Primer
(F):5'- tcaatccttctgtctcagcc -3'
(R):5'- ACAGTTTTCCCAAGGCCCATC -3'

Posted On

2013-05-23