Mutagenetix > Incidental Mutation

Incidental Mutation 'R5265:Slc34a2'

401640

Institutional Source

Beutler Lab

Gene Symbol

Slc34a2

Ensembl Gene

ENSMUSG00000029188

Gene Name

solute carrier family 34 (sodium phosphate), member 2

Synonyms

D5Ertd227e, type IIb Na/Picotransporter, Npt2b, NaPi-2b

MMRRC Submission

042833-MU

Accession Numbers

Genbank: NM_011402; MGI: 1342284

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R5265 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

53038081-53071664 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 53061434 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Threonine at position 198 (I198T)

Ref Sequence

ENSEMBL: ENSMUSP00000092380 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000094787] [ENSMUST00000170523]

AlphaFold

Q9DBP0

Predicted Effect

probably damaging
Transcript: ENSMUST00000094787
AA Change: I198T

PolyPhen 2 Score 0.962 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000092380
Gene: ENSMUSG00000029188
AA Change: I198T

Domain	Start	End	E-Value	Type
Pfam:Na_Pi_cotrans	110	252	2.3e-26	PFAM
Pfam:Na_Pi_cotrans	374	551	2.6e-17	PFAM
low complexity region	553	570	N/A	INTRINSIC
low complexity region	616	645	N/A	INTRINSIC
low complexity region	649	655	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000147243

Predicted Effect

probably damaging
Transcript: ENSMUST00000168667
AA Change: I198T

PolyPhen 2 Score 0.961 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000132328
Gene: ENSMUSG00000029188
AA Change: I198T

Domain	Start	End	E-Value	Type
Pfam:Na_Pi_cotrans	110	253	1.2e-33	PFAM
Pfam:Na_Pi_cotrans	379	517	4.1e-15	PFAM
low complexity region	557	586	N/A	INTRINSIC
low complexity region	590	596	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000170523

SMART Domains

Protein: ENSMUSP00000130692
Gene: ENSMUSG00000029188

Domain	Start	End	E-Value	Type
Pfam:Na_Pi_cotrans	110	187	2.9e-20	PFAM

Meta Mutation Damage Score

0.9723

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.0%
20x: 94.7%

Validation Efficiency

100% (59/59)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a pH-sensitive sodium-dependent phosphate transporter. Phosphate uptake is increased at lower pH. Defects in this gene are a cause of pulmonary alveolar microlithiasis. Three transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, May 2010]
PHENOTYPE: Homozygous null mice display embryonic lethality, embryonic growth arrest, failure of embryo turning and somitogenesis, impaired placental development and impaired yolk sac vascular remodeling. [provided by MGI curators]

Allele List at MGI

All alleles(3) : Targeted, knock-out(1) Targeted, other(2)

Other mutations in this stock

Total: 56 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700017B05Rik	A	G	9: 57,258,894	W66R	probably damaging	Het
Adamts3	A	G	5: 89,861,552	V84A	possibly damaging	Het
Caap1	C	A	4: 94,501,228	E290*	probably null	Het
Cant1	G	A	11: 118,408,050	R296C	probably damaging	Het
Ccdc114	T	A	7: 45,947,435	D395E	probably damaging	Het
Cdh5	A	T	8: 104,142,739	H699L	probably benign	Het
Cfdp1	T	C	8: 111,830,985	T175A	probably benign	Het
Col4a4	C	T	1: 82,493,591	G681E	unknown	Het
Comtd1	G	A	14: 21,848,793	T27I	probably benign	Het
Copg1	T	A	6: 87,892,270	V155D	probably damaging	Het
Dag1	A	G	9: 108,207,699	Y748H	possibly damaging	Het
Dmwd	T	A	7: 19,080,281	N285K	possibly damaging	Het
Dsp	A	G	13: 38,195,183	E1968G	possibly damaging	Het
Ednra	A	G	8: 77,667,375	I364T	probably damaging	Het
Elovl3	C	A	19: 46,134,681	T232K	probably damaging	Het
Ercc3	T	A	18: 32,254,243	I503N	probably damaging	Het
Ercc6	C	A	14: 32,569,623	A1008D	probably benign	Het
Gm10563	TTTC	TTTCATTC	4: 155,614,496		probably null	Het
H2-DMb2	G	T	17: 34,148,562	V117F	probably damaging	Het
Helt	A	T	8: 46,292,433	W138R	probably damaging	Het
Itga11	A	T	9: 62,737,412	H215L	probably benign	Het
Kcnn1	T	A	8: 70,854,653	I156F	probably benign	Het
Kdm1b	A	G	13: 47,062,969	N272D	probably benign	Het
Kdm2b	T	C	5: 122,878,588	T1161A	probably damaging	Het
Lin54	A	G	5: 100,485,519	L102P	probably damaging	Het
Mlh1	A	C	9: 111,271,523	M1R	probably null	Het
Naip2	G	A	13: 100,152,560	L1165F	probably damaging	Het
Nfkbiz	A	G	16: 55,819,641	S118P	probably damaging	Het
Nkx3-2	T	A	5: 41,761,848	M266L	probably benign	Het
Npr1	T	C	3: 90,457,002	E771G	probably benign	Het
Obox8	C	T	7: 14,332,029	R188H	probably benign	Het
Olfr187	A	T	16: 59,036,143	V198D	possibly damaging	Het
Olfr497	T	A	7: 108,423,402	V277E	possibly damaging	Het
Palm3	T	C	8: 84,021,530		probably null	Het
Palmd	A	T	3: 116,923,849	V333D	possibly damaging	Het
Pikfyve	A	G	1: 65,267,829	E1747G	possibly damaging	Het
Polr3a	T	C	14: 24,454,941	I1084V	possibly damaging	Het
Ranbp3l	T	A	15: 9,007,203	F127I	probably benign	Het
Rsl1d1	A	G	16: 11,201,384	F97L	possibly damaging	Het
Scaper	A	G	9: 55,864,546	V362A	probably benign	Het
Scg5	A	T	2: 113,776,865	L192*	probably null	Het
Slc45a3	T	A	1: 131,978,194	D318E	possibly damaging	Het
Sorl1	A	G	9: 42,106,516	M105T	possibly damaging	Het
St3gal5	T	A	6: 72,149,131	I320N	probably damaging	Het
Stx17	A	G	4: 48,183,470		probably benign	Het
Syt5	C	T	7: 4,541,075		probably null	Het
Thrap3	A	G	4: 126,167,640	S774P	probably damaging	Het
Tnc	A	T	4: 63,993,206	M1376K	probably benign	Het
Tnks1bp1	T	A	2: 85,062,754	D1008E	probably benign	Het
Trav7-1	G	T	14: 52,655,304	A105S	probably damaging	Het
Vmn1r28	T	A	6: 58,265,964	V264D	probably damaging	Het
Vmn1r44	T	C	6: 89,893,839	V46A	probably benign	Het
Vmn2r10	A	G	5: 108,995,720	I788T	probably damaging	Het
Vmn2r78	T	A	7: 86,920,124	I75N	probably damaging	Het
Zfp821	T	C	8: 109,724,359	M328T	probably damaging	Het
Zfp995	G	A	17: 21,880,623	P210L	possibly damaging	Het

Other mutations in Slc34a2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00785:Slc34a2	APN	5	53065608	missense	probably benign	0.06
IGL00845:Slc34a2	APN	5	53058354	splice site	probably benign
IGL01024:Slc34a2	APN	5	53067630	missense	possibly damaging	0.61
IGL01300:Slc34a2	APN	5	53068127	critical splice acceptor site	probably null
IGL01680:Slc34a2	APN	5	53060876	missense	probably damaging	1.00
IGL02226:Slc34a2	APN	5	53067731	missense	probably benign	0.12
IGL02682:Slc34a2	APN	5	53059238	missense	possibly damaging	0.64
IGL03294:Slc34a2	APN	5	53063998	missense	probably benign	0.00
tucumcari	UTSW	5	53064009	missense	possibly damaging	0.68
D4216:Slc34a2	UTSW	5	53065497	missense	probably benign	0.01
R0094:Slc34a2	UTSW	5	53063968	missense	probably benign	0.28
R0227:Slc34a2	UTSW	5	53069626	missense	possibly damaging	0.51
R0524:Slc34a2	UTSW	5	53064873	nonsense	probably null
R0836:Slc34a2	UTSW	5	53067707	missense	probably benign
R1525:Slc34a2	UTSW	5	53069506	missense	probably benign	0.00
R1655:Slc34a2	UTSW	5	53069419	missense	probably benign	0.00
R1753:Slc34a2	UTSW	5	53061391	missense	probably benign	0.37
R1838:Slc34a2	UTSW	5	53058436	missense	probably benign
R2361:Slc34a2	UTSW	5	53068145	missense	probably benign	0.10
R2405:Slc34a2	UTSW	5	53058181	missense	probably benign	0.04
R3688:Slc34a2	UTSW	5	53064832	missense	probably benign	0.06
R4108:Slc34a2	UTSW	5	53064009	missense	possibly damaging	0.68
R4176:Slc34a2	UTSW	5	53067568	missense	probably damaging	1.00
R4380:Slc34a2	UTSW	5	53069286	missense	probably damaging	1.00
R4464:Slc34a2	UTSW	5	53069182	missense	probably damaging	0.99
R4780:Slc34a2	UTSW	5	53069451	missense	probably damaging	1.00
R4816:Slc34a2	UTSW	5	53069020	missense	probably damaging	1.00
R4934:Slc34a2	UTSW	5	53067600	missense	probably damaging	1.00
R5309:Slc34a2	UTSW	5	53069488	missense	probably damaging	0.96
R5313:Slc34a2	UTSW	5	53069339	missense	probably damaging	0.96
R5884:Slc34a2	UTSW	5	53069380	missense	possibly damaging	0.46
R6084:Slc34a2	UTSW	5	53067647	missense	possibly damaging	0.91
R6310:Slc34a2	UTSW	5	53064797	critical splice acceptor site	probably null
R6568:Slc34a2	UTSW	5	53069134	missense	probably damaging	1.00
R6817:Slc34a2	UTSW	5	53064028	missense	probably damaging	0.98
R6845:Slc34a2	UTSW	5	53069169	missense	probably damaging	0.96
R6944:Slc34a2	UTSW	5	53064883	missense	probably benign
R7873:Slc34a2	UTSW	5	53058372	missense	probably benign	0.02
R8114:Slc34a2	UTSW	5	53068359	missense	probably benign	0.00
R8158:Slc34a2	UTSW	5	53060840	missense	probably damaging	1.00
R8364:Slc34a2	UTSW	5	53068374	missense	possibly damaging	0.75
R9158:Slc34a2	UTSW	5	53063875	missense	possibly damaging	0.95
R9235:Slc34a2	UTSW	5	53069325	missense	probably benign	0.00
R9314:Slc34a2	UTSW	5	53060801	missense	possibly damaging	0.61
Z1176:Slc34a2	UTSW	5	53060817	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AATATTTAGCCGCAGTGTGTTC -3'
(R):5'- TGCCTGCATGACTGTGTAATC -3'

Sequencing Primer
(F):5'- TAGCCGCAGTGTGTTCATCCC -3'
(R):5'- CTAGCTTTACAGATCCGTAAGTGG -3'

Posted On

2016-07-06